We used the Clustered Regularly Interspaced Short Palindromic Repeats associated protein Cas9 (CRISPR/Cas9) technology (Cong et al. 2013; Mali et al. 2013) to generate a transgenic mouse line that expresses Cre recombinase in Prokr2-expressing cells. A single guide RNA (sgRNA) target and protospacer adjacent motif was identified on the coding strand: 5’ CCTCGACCTCAAAACCAGCG GGG3 3’ with a predicted cut site 44 bp upstream of the termination codon. The sgRNA target is located at mouse chromosome 2, nucleotides 132373439-132373459 (NCBI Reference Sequence: NC_000068.7). The activity of sgRNA/Cas9 complex at the target was demonstrated by analysis of genomic DNA extracted from blastocysts that developed in in vitro culture from mouse zygotes that had been microinjected with Cas9 reagents, as described (Sakurai et al. 2014). DNA sequence analysis of PCR products obtained by amplification across the Cas9 target showed the presence of insertions/deletions (indels) in the genomic DNA due to non-homologous end joining repair of double-strand chromosome breaks induced by sgRNA/Cas9 complexes. After the demonstration of effective Cas9 cleavage of the target, a donor plasmid for homology directed repair was synthesized that included 800 bp of sequence upstream of the sgRNA target. Multiple silent coding changes were introduced in the Cas9 target to block Cas9 re-cleavage after correct repair of chromosome breaks by the donor DNA: 5’ CCTCGACtTaAAgACatctG GcG 3’. Between the final Prokr2 codon and termination codon a GSG linker, a T2A viral peptide, an iCre recombinase, and a bovine growth hormone polyadenylation signal (bPA) were inserted (Goodwin and Rottman 1992; Kim et al. 2011; Shimshek et al. 2002). Immediately downstream of the bPA was the endogenous Prokr2 termination codon and 797 bp of genomic sequence that comprised the 800 bp 3’ arm of homology. The sgRNA target was cloned into the plasmid pX330 (Addgene.org plasmid #42230, a kind gift of Feng Zhang) as described (Ran et al. 2013). The circular pX330 plasmid (5 ng/uL final concentration) (Mashiko et al. 2013) and circular donor plasmid (10 ng/uL final concentration) were mixed together for microinjection. Fertilized eggs were produced by mating superovulated B6SJLF1 with B6SJLF1 males (JAX Strain #100012). Pronuclear microinjection was carried out as described (Becker and Jechow 2011; Van Keuren et al. 2009). A total of 293 zygotes were microinjected, 255 surviving zygotes were transferred to B6D2F1 (JAX Strain #100006) pseudopregnant female mice and 85 pups were born. Genotyping of genomic DNA extracted from tail tip biopsies was performed by PCR with primers internal to and external to the DNA donor plasmid, and confirmed by DNA sequencing analysis. Single copy integration was confirmed by PCR. Two primers pairs were used. The 5’ pair included a primer outside the 5’ arm of homology and one inside Cre recombinase. The 3’ pair included a primer outside the 3’ arm of homology and one inside Cre recombinase. Following identification of Prokr2-Cre founders, quantitative PCR of genomic iCre was performed to determine the integration events in heterozygous and homozygous mice. Interleukin 2 (Il2 gene) was used as a random control for positive homozygosity.