MMRRC Logo

PCR Protocol

PCR Protocol at Donor's Lab for MMRRC:0001

The genotyping protocol is a simple PCR where one primer matches the vector arm and the second primer is adjacent mouse sequence.

      Primers: 
      forward primer is:  5' GGCCGTCGACATTTAGGTGACAC
      reverse primer is:  5' AGTCAATTTGGTCACTAACCGCC
	 
      Cycles:
	40 at 95 C, one min; 
	 1 at 53 C, one min; 
	 1 at 72 C, 30 sec.
      

Agarose gel:   The transgene positive animals show a 320 bp product and negative animals show no band.

 

MMRRC Contact Information     Home Page
The MMRRC is a collaborative effort, funded by grants from the National Center for Research Resources, NCRR logo NIH, DHHS.

Web forms on this site assume JavaScript enabled for Netscape 6.x, Microsoft Internet Explorer 5.5 and later versions; forms will not function as expected with earlier versions or when JavaScript is turned off.

Last Modified: June 01, 2005