Strain Name:
C57BL/6J-MtgxR1132Btlr/Mmmh
Stock Number:
039205-MU
Citation ID:
RRID:MMRRC_039205-MU
Other Names:
R1132 (G1), C57BL/6J-MtgxR1132Btlr
Major Collection:

Strain Information

Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Cdk8
Name: cyclin dependent kinase 8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 264064
HGNC: HGNC:1779
Homologene: 55565
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Cep170
Name: centrosomal protein 170
Synonyms: 4933426L22Rik, A330004A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545389
Homologene: 22844
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2LG, A2D, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Rad50
Name: RAD50 double strand break repair protein
Synonyms: Rad50l, Mrell
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19360
HGNC: HGNC:9816
Homologene: 38092
Zfp961
Name: zinc finger protein 961
Synonyms: A230105L22Rik, BC049349
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234413
Homologene: 136286
Tfap2a
Name: transcription factor AP-2, alpha
Synonyms: Ap-2 (a), AP-2 alpha, Ap2tf, Ap2, Tcfap2a, AP2alpha
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21418
VEGA: 13
Homologene: 2421
Inpp5j
Name: inositol polyphosphate 5-phosphatase J
Synonyms: Pipp, Pib5pa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170835
HGNC: HGNC:8956
Homologene: 8682
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Car9
Name: carbonic anhydrase 9
Synonyms: CAIX, MN/CA9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230099
HGNC: HGNC:1383
Homologene: 20325
Itsn2
Name: intersectin 2
Synonyms: Sh3p18, Ese2, Eh domain, SH3 domain regulator of endocytosis 2, Sh3d1B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20403
VEGA: 12
HGNC: HGNC:6184
Homologene: 22627
Prdm4
Name: PR domain containing 4
Synonyms: 2810470D21Rik, SC-1, 1700031E19Rik, SC1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72843
VEGA: 10
HGNC: HGNC:9348
Homologene: 8235
Sec63
Name: SEC63 homolog, protein translocation regulator
Synonyms: 5730478J10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140740
Homologene: 5220
Dhx37
Name: DEAH-box helicase 37
Synonyms: LOC381671, LOC208144
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208144
Homologene: 6641
Trhde
Name: TRH-degrading enzyme
Synonyms: 9330155P21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237553
Homologene: 75007
Cib1
Name: calcium and integrin binding 1
Synonyms: Kip
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23991
Homologene: 4654
Zdhhc25
Name: zinc finger, DHHC domain containing 25
Synonyms: 1700030J15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70073
Homologene: 19298
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Slc38a4
Name: solute carrier family 38, member 4
Synonyms: Ata3, 1700012A18Rik, 1110012E16Rik, SNAT4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69354
VEGA: 15
Homologene: 75077
Kif1a
Name: kinesin family member 1A
Synonyms: Kns1, ATSV, N-3 kinesin, LOC381283, C630002N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16560
HGNC: HGNC:888
Homologene: 99729
Stac3
Name: SH3 and cysteine rich domain 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237611
Homologene: 17039
Apba1
Name: amyloid beta precursor protein binding family A member 1
Synonyms: X11alpha, Lin-10, X11, Mint1, Mint, 6430513E09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 319924
VEGA: 19
HGNC: HGNC:578
Homologene: 897
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Vmn1r22
Name: vomeronasal 1 receptor 22
Synonyms: V1rc23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171196
Homologene: 110825
Zfp202
Name: zinc finger protein 202
Synonyms: C130037E22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80902
Homologene: 68317
Vmn1r39
Name: vomeronasal 1 receptor 39
Synonyms: Gm5993
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 546903
Homologene: 110800
Or2ag17
Name: olfactory receptor family 2 subfamily AG member 17
Synonyms: GA_x6K02T2PBJ9-9168355-9167405, MOR283-10P, Olfr699
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258180
Homologene: 79391
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Selenbp1
Name: selenium binding protein 1
Synonyms: Lp56, Lpsb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20341
Homologene: 2930
Cd163
Name: CD163 antigen
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93671
HGNC: HGNC:1631
Homologene: 128811
Or14a257
Name: olfactory receptor family 14 subfamily A member 257
Synonyms: GA_x6K02T2NHDJ-9619796-9620794, MOR219-4, Olfr298
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257905
Or12d12
Name: olfactory receptor family 12 subfamily D member 12
Synonyms: MOR250-2, GA_x6K02T2PSCP-1761617-1760691, Olfr101
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258831
Homologene: 133728
Prss53
Name: serine protease 53
Synonyms: BC039632
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330657
Homologene: 80097
Or14j4
Name: olfactory receptor family 14 subfamily J member 4
Synonyms: MOR218-11P, GA_x6K02T2PSCP-2070203-2069271, Olfr115
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257908
Homologene: 115497
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 93,056,021 bp
  • C to A, chromosome 1 at 176,750,037 bp
  • C to G, chromosome 3 at 94,937,333 bp
  • G to T, chromosome 4 at 43,512,439 bp
  • A to G, chromosome 4 at 112,898,099 bp
  • T to C, chromosome 4 at 148,551,030 bp
  • A to T, chromosome 5 at 125,421,039 bp
  • A to G, chromosome 5 at 146,299,815 bp
  • T to C, chromosome 6 at 57,900,841 bp
  • C to T, chromosome 6 at 66,804,444 bp
  • G to T, chromosome 6 at 124,309,096 bp
  • A to G, chromosome 7 at 80,228,030 bp
  • A to T, chromosome 7 at 86,489,217 bp
  • A to T, chromosome 7 at 106,790,551 bp
  • T to C, chromosome 7 at 119,939,004 bp
  • A to G, chromosome 7 at 123,000,113 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 7 at 126,494,248 bp
  • A to G, chromosome 7 at 127,888,287 bp
  • T to C, chromosome 8 at 71,965,788 bp
  • ACGGCGCGGCG to ACGGCGCGGCGCGGCG, chromosome 8 at 121,552,276 bp
  • CGCGG to CGCGGAGCGG, chromosome 8 at 121,552,280 bp
  • T to C, chromosome 9 at 40,211,022 bp
  • T to A, chromosome 10 at 42,828,888 bp
  • A to G, chromosome 10 at 85,899,281 bp
  • T to C, chromosome 10 at 114,412,478 bp
  • T to C, chromosome 10 at 127,507,259 bp
  • T to C, chromosome 11 at 3,502,305 bp
  • T to C, chromosome 11 at 53,694,961 bp
  • C to T, chromosome 11 at 67,297,131 bp
  • T to C, chromosome 11 at 119,285,059 bp
  • T to C, chromosome 12 at 4,658,464 bp
  • T to C, chromosome 13 at 40,721,391 bp
  • T to C, chromosome 15 at 88,600,723 bp
  • T to A, chromosome 15 at 97,016,115 bp
  • T to C, chromosome 17 at 37,299,532 bp
  • G to T, chromosome 17 at 37,610,442 bp
  • C to T, chromosome 17 at 57,207,531 bp
  • G to A, chromosome 17 at 58,294,356 bp
  • TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGA, chromosome 18 at 25,020,665 bp
  • T to C, chromosome 18 at 77,429,943 bp
  • T to C, chromosome 19 at 23,917,553 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1132 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039205-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.