Strain Name:
C57BL/6J-MtgxR2881Btlr/Mmmh
Stock Number:
040469-MU
Citation ID:
RRID:MMRRC_040469-MU
Other Names:
R2881 (G1), C57BL/6J-MtgxR2881Btlr
Major Collection:

Strain Information

Ewsr1
Name: Ewing sarcoma breakpoint region 1
Synonyms: Ews
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14030
HGNC: HGNC:3508
Homologene: 134632
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Zfp871
Name: zinc finger protein 871
Synonyms: 9030612M13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 208292
Homologene: 138401
Atp4a
Name: ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms: H+K+-transporting alpha 1, H+/K+-ATPase alpha
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11944
HGNC: HGNC:819
Homologene: 68081
Gpatch8
Name: G patch domain containing 8
Synonyms: Fbm1, ENSMUSG00000075516, 5430405G24Rik, Gpatc8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237943
Homologene: 46117
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Camta2
Name: calmodulin binding transcription activator 2
Synonyms: Kiaa0909-hp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216874
Homologene: 9021
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Prp9-1, Chd7, 2600010P09Rik, Mi-2 alpha, Prp7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Cyp2j9
Name: cytochrome P450, family 2, subfamily j, polypeptide 9
Synonyms: 8430417E17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74519
HGNC: HGNC:2634
Homologene: 137388
Faap100
Name: Fanconi anemia core complex associated protein 100
Synonyms: 2310003H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71885
Homologene: 69394
Arhgef38
Name: Rho guanine nucleotide exchange factor 38
Synonyms: D630013G24Rik, 9130221D24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77669
Homologene: 137396
Vmn2r88
Name: vomeronasal 2, receptor 88
Synonyms: V2r13, V2r3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 669149
Homologene: 129606
Slfn10-ps
Name: schlafen 10, pseudogene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 237887
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Dhx30
Name: DExH-box helicase 30
Synonyms: 2810477H02Rik, C130058C04Rik, DEAH (Asp-Glu-Ala-His) box polypeptide 30, Ddx30, helG
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72831
Homologene: 15779
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Plxnb1
Name: plexin B1
Synonyms: 2900002G15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235611
HGNC: HGNC:9103
Homologene: 130508
Ces1d
Name: carboxylesterase 1D
Synonyms: TGH, Ces3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
AC149051.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Pex5l
Name: peroxisomal biogenesis factor 5-like
Synonyms: PXR2, Pex2, 1700016J08Rik, TRIP8b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58869
Homologene: 9562
Tgm6
Name: transglutaminase 6
Synonyms: TGM3L
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241636
Homologene: 27970
Irf2bpl
Name: interferon regulatory factor 2 binding protein-like
Synonyms: 6430527G18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238330
VEGA: 12
Homologene: 11555
Galc
Name: galactosylceramidase
Synonyms: galactocerebrosidase, A930008M05Rik, Gacy, 2310068B06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14420
VEGA: 12
HGNC: HGNC:4115
Homologene: 124
Pira13
Name: paired-Ig-like receptor A13
Synonyms: ENSMUSG00000074419, Gm15448
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041146
Homologene: 134028
Hace1
Name: HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms: A730034A22Rik, 1700042J16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209462
Homologene: 10807
Serpinb13
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms: HURPIN, PI13, headpin, HUR7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241196
HGNC: HGNC:8944
Homologene: 22718
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Or4a47
Name: olfactory receptor family 4 subfamily A member 47
Synonyms: MOR231-1, Olfr1256, GA_x6K02T2Q125-51276848-51275928
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258985
Homologene: 128157
She
Name: src homology 2 domain-containing transforming protein E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214547
Homologene: 18186
Coasy
Name: Coenzyme A synthase
Synonyms: Ppat, 1300003G02Rik, Dpck, Ukr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71743
Homologene: 11889
Or5ac24
Name: olfactory receptor family 5 subfamily AC member 24
Synonyms: MOR182-4, Olfr206, GA_x54KRFPKG5P-55560552-55559632
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258993
Homologene: 74262
Tfec
Name: transcription factor EC
Synonyms: TFEC, Tcfec, bHLHe34
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21426
Homologene: 32148
A430018G15Rik
Name: RIKEN cDNA A430018G15 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 115489452
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 106,994,123 bp
  • ATGTTTGTTTGTTTGTTTGTTTGTTTGTTT to ATGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTT, chromosome 2 at 52,434,451 bp
  • GTTT to GTTTCTTT, chromosome 2 at 52,434,473 bp
  • T to C, chromosome 2 at 89,844,984 bp
  • T to C, chromosome 2 at 130,137,439 bp
  • T to C, chromosome 2 at 168,706,214 bp
  • T to A, chromosome 3 at 32,993,003 bp
  • A to G, chromosome 3 at 55,647,358 bp
  • T to A, chromosome 3 at 89,831,924 bp
  • G to A, chromosome 3 at 133,146,565 bp
  • A to T, chromosome 4 at 96,574,012 bp
  • T to A, chromosome 6 at 16,835,233 bp
  • T to A, chromosome 7 at 3,825,641 bp
  • G to A, chromosome 7 at 30,720,225 bp
  • T to A, chromosome 8 at 33,574,907 bp
  • T to C, chromosome 8 at 63,927,536 bp
  • C to A, chromosome 8 at 93,195,031 bp
  • C to T, chromosome 9 at 108,113,067 bp
  • T to A, chromosome 9 at 109,114,412 bp
  • A to T, chromosome 9 at 110,098,845 bp
  • T to A, chromosome 10 at 45,671,134 bp
  • C to A, chromosome 11 at 5,078,523 bp
  • T to C, chromosome 11 at 69,352,120 bp
  • A to T, chromosome 11 at 70,679,664 bp
  • A to T, chromosome 11 at 83,030,095 bp
  • G to A, chromosome 11 at 101,085,849 bp
  • A to G, chromosome 11 at 102,479,917 bp
  • T to C, chromosome 11 at 120,374,359 bp
  • T to A, chromosome 12 at 86,882,777 bp
  • A to G, chromosome 12 at 98,213,096 bp
  • G to T, chromosome 14 at 51,418,689 bp
  • A to T, chromosome 16 at 59,344,852 bp
  • T to C, chromosome 17 at 32,775,433 bp
  • A to G, chromosome 19 at 41,583,049 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2881 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040469-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.