Strain Name:
C57BL/6J-MtgxR3607Btlr/Mmmh
Stock Number:
040671-MU
Citation ID:
RRID:MMRRC_040671-MU
Other Names:
R3607 (G1), C57BL/6J-MtgxR3607Btlr
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, DPEAAE, Cspg2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Etv1
Name: ets variant 1
Synonyms: ER81, Etsrp81
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14009
HGNC: HGNC:3490
Homologene: 3636
Fam131a
Name: family with sequence similarity 131, member A
Synonyms: 2900046G09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78408
Homologene: 82234
Cep70
Name: centrosomal protein 70
Synonyms: 6720484E09Rik, C030018L16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68121
Homologene: 11387
Wasf1
Name: WASP family, member 1
Synonyms: WAVE-1, Scar, WAVE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83767
Homologene: 2920
Psmd3
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Synonyms: AntP91a, Psd3, Tstap91a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22123
HGNC: HGNC:9560
Homologene: 2102
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Ptpn1
Name: protein tyrosine phosphatase, non-receptor type 1
Synonyms: PTP-1B, PTP1B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19246
HGNC: HGNC:9642
Homologene: 2119
Traf2
Name: TNF receptor-associated factor 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22030
Homologene: 22520
Lpin2
Name: lipin 2
Synonyms: 2610511G02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64898
Homologene: 8769
Impdh2
Name: inosine monophosphate dehydrogenase 2
Synonyms: IMP dehydrogenase type II
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23918
HGNC: HGNC:6053
Homologene: 48919
Arhgef17
Name: Rho guanine nucleotide exchange factor 17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207212
Homologene: 129601
Adnp2
Name: ADNP homeobox 2
Synonyms: Zfp508, 8430420L05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240442
Homologene: 8945
Fgfrl1
Name: fibroblast growth factor receptor-like 1
Synonyms: fibroblast growth factor receptor 5, FGFR5gamma, FGFR5beta, FGFR5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116701
HGNC: HGNC:3693
Homologene: 11067
Lctl
Name: lactase-like
Synonyms: KLPH, E130104I05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235435
Homologene: 70710
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Ranbp10
Name: RAN binding protein 10
Synonyms: 4432417N03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74334
Homologene: 49639
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Fam13b
Name: family with sequence similarity 13, member B
Synonyms: 2610024E20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225358
VEGA: 18
HGNC: HGNC:1335
Homologene: 9585
Bpifb1
Name: BPI fold containing family B, member 1
Synonyms: von Ebner minor salivary protein, LPlunc1, U46068
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228801
Homologene: 50047
Prkg2
Name: protein kinase, cGMP-dependent, type II
Synonyms: cGK-II, Prkgr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19092
HGNC: HGNC:9416
Homologene: 4556
Yif1b
Name: Yip1 interacting factor homolog B (S. cerevisiae)
Synonyms: 9430029K10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77254
Homologene: 60114
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Cracr2b
Name: calcium release activated channel regulator 2B
Synonyms: 6330520A15Rik, Efcab4a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 213573
Homologene: 45468
Or14a258
Name: olfactory receptor family 14 subfamily A member 258
Synonyms: GA_x6K02T2NHDJ-9721756-9722757, MOR219-3P, Olfr304
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258089
Homologene: 121542
Tnfaip3
Name: tumor necrosis factor, alpha-induced protein 3
Synonyms: A20, zinc finger protein A20, Tnfip3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21929
Homologene: 4582
Ogdhl
Name: oxoglutarate dehydrogenase-like
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239017
VEGA: 14
Homologene: 56801
Kprp
Name: keratinocyte expressed, proline-rich
Synonyms: 1110001M24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433619
Homologene: 54921
Myom2
Name: myomesin 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Rgl3
Name: ral guanine nucleotide dissociation stimulator-like 3
Synonyms: 1300003D20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71746
VEGA: 9
Homologene: 11363
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
F830016B08Rik
Name: RIKEN cDNA F830016B08 gene
Synonyms: Ifgga4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240328
VEGA: 18
Homologene: 129714
Slc28a2
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 2
Synonyms: CNT2, 2010208B10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269346
Homologene: 20891
Aurkc
Name: aurora kinase C
Synonyms: AIK3, AIE1, Stk13, IAK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20871
Homologene: 68302
Nkrf
Name: NF-kappaB repressing factor
Synonyms: 9430034D17Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 77286
Homologene: 84816
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Kng1
Name: kininogen 1
Synonyms: L-kininogen, H-kininigen
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16644
HGNC: HGNC:6383
Homologene: 88343
Gmfg
Name: glia maturation factor, gamma
Synonyms: 0610039G16Rik, 2310057N07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 63986
HGNC: HGNC:4374
Homologene: 37978
Nt5c1b
Name: 5'-nucleotidase, cytosolic IB
Synonyms: 4921514H13Rik, CN-IB
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70881
Homologene: 12370
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
4930510E17Rik
Name: RIKEN cDNA 4930510E17 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Usp11
Name: ubiquitin specific peptidase 11
Synonyms: 6230415D12Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236733
Homologene: 31252
Gtpbp8
Name: GTP-binding protein 8 (putative)
Synonyms: 0610037H22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66067
Homologene: 32209
Tex16
Name: testis expressed gene 16
Synonyms: 4933403O08Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 83556
Homologene: 130788
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 14,270,853 bp
  • T to A, chromosome 1 at 139,480,668 bp
  • T to C, chromosome 2 at 25,530,415 bp
  • T to C, chromosome 2 at 122,460,406 bp
  • T to A, chromosome 2 at 154,211,565 bp
  • A to T, chromosome 2 at 157,177,233 bp
  • A to G, chromosome 2 at 167,975,507 bp
  • C to A, chromosome 3 at 92,824,281 bp
  • G to T, chromosome 5 at 98,947,377 bp
  • C to A, chromosome 5 at 108,705,423 bp
  • T to G, chromosome 6 at 146,227,601 bp
  • A to G, chromosome 7 at 7,002,860 bp
  • T to A, chromosome 7 at 28,441,536 bp
  • C to T, chromosome 7 at 29,238,410 bp
  • A to G, chromosome 7 at 86,385,695 bp
  • C to A, chromosome 7 at 100,931,172 bp
  • C to T, chromosome 7 at 141,466,146 bp
  • T to C, chromosome 8 at 15,069,775 bp
  • A to G, chromosome 8 at 105,776,035 bp
  • A to G, chromosome 9 at 21,987,691 bp
  • G to A, chromosome 9 at 44,849,196 bp
  • C to A, chromosome 9 at 53,279,783 bp
  • T to C, chromosome 9 at 64,133,193 bp
  • T to C, chromosome 9 at 99,275,759 bp
  • T to C, chromosome 9 at 108,563,349 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 10 at 19,005,602 bp
  • G to C, chromosome 10 at 40,936,384 bp
  • T to A, chromosome 11 at 55,281,685 bp
  • C to T, chromosome 11 at 98,690,954 bp
  • C to A, chromosome 11 at 119,441,976 bp
  • A to G, chromosome 12 at 10,377,236 bp
  • A to G, chromosome 12 at 29,990,918 bp
  • A to G, chromosome 12 at 38,831,086 bp
  • T to A, chromosome 12 at 81,928,292 bp
  • G to T, chromosome 13 at 89,703,301 bp
  • T to A, chromosome 14 at 32,335,361 bp
  • C to T, chromosome 16 at 20,701,595 bp
  • T to C, chromosome 16 at 23,067,802 bp
  • T to C, chromosome 16 at 44,743,756 bp
  • T to A, chromosome 17 at 71,229,392 bp
  • T to C, chromosome 17 at 78,834,217 bp
  • G to T, chromosome 18 at 25,060,311 bp
  • T to A, chromosome 18 at 34,473,696 bp
  • A to T, chromosome 18 at 60,300,708 bp
  • A to T, chromosome 18 at 80,129,069 bp
  • T to G, chromosome X at 20,714,632 bp
  • T to G, chromosome X at 36,890,077 bp
  • T to A, chromosome X at 112,093,970 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3607 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040671-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.