Strain Name:
C57BL/6J-MtgxR4682Btlr/Mmmh
Stock Number:
041934-MU
Citation ID:
RRID:MMRRC_041934-MU
Other Names:
R4682 (G1), C57BL/6J-MtgxR4682Btlr
Major Collection:

Strain Information

Fgb
Name: fibrinogen beta chain
Synonyms: 2510049G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110135
HGNC: HGNC:3662
Homologene: 3772
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Ctnnal1
Name: catenin alpha like 1
Synonyms: ACRP, Catnal1, catenin (cadherin associated protein), alpha-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Mark4
Name: MAP/microtubule affinity regulating kinase 4
Synonyms: Markl1, 2410090P21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232944
Homologene: 57146
Rlig1
Name: RNA 5'-phosphate and 3'-OH ligase 1
Synonyms: 4930430F08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68281
VEGA: 10
Homologene: 18409
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Traf7
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224619
Homologene: 12998
Grhl1
Name: grainyhead like transcription factor 1
Synonyms: p70 MGR, p61 MGR, LBP-32, Tcfcp2l2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 195733
VEGA: 12
Homologene: 32219
Tap2
Name: transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms: MTP2, PSF2, Ham2, Ham-2, Tap-2, HAM2, Abcb3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21355
HGNC: HGNC:44
Homologene: 37323
Mrpl48
Name: mitochondrial ribosomal protein L48
Synonyms: 1810030E20Rik, CGI-118, D4Ertd786e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52443
Homologene: 32294
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, D13Ucla1, 2810425C21Rik, DAP-Kinase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Pcyt1b
Name: phosphate cytidylyltransferase 1, choline, beta isoform
Synonyms: CTTbeta
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 236899
HGNC: HGNC:8755
Homologene: 3564
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, Plekhm1l, 9430067K14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
St6galnac4
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4
Synonyms: ST6GalNAc IV, Siat7d
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20448
Homologene: 7939
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Myo1c
Name: myosin IC
Synonyms: myosin-Ibeta, myr2, C80397, mm1beta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17913
HGNC: HGNC:7597
Homologene: 32046
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: inter-alpha (globulin) inhibitor, H1 polypeptide, Intin1, Itih-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Nlrp4d
Name: NLR family, pyrin domain containing 4D
Synonyms: Nalp-beta, Nalp4d
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 384752
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Hdgfl1
Name: HDGF like 1
Synonyms: HRP-1, Hdgfrp1, Pwwp1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15192
Homologene: 56406
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Slc46a1
Name: solute carrier family 46, member 1
Synonyms: 1110002C08Rik, D11Ertd18e, HCP1, heme carrier protein 1, PCFT
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52466
Homologene: 41693
Aurkc
Name: aurora kinase C
Synonyms: AIK3, AIE1, Stk13, IAK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20871
Homologene: 68302
Inpp1
Name: inositol polyphosphate-1-phosphatase
Synonyms: 2300002C06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16329
HGNC: HGNC:6071
Homologene: 1655
Slc36a4
Name: solute carrier family 36 (proton/amino acid symporter), member 4
Synonyms: PAT4, 6330573I15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234967
Homologene: 56300
Zfp111
Name: zinc finger protein 111
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56707
Homologene: 128597
Dpm2
Name: dolichyl-phosphate mannosyltransferase subunit 2, regulatory
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13481
HGNC: HGNC:3006
Homologene: 99726
Or4d6
Name: olfactory receptor family 4 subfamily D member 6
Synonyms: GA_x6K02T2RE5P-2468394-2467450, MOR239-5, Olfr1428
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258673
Homologene: 17339
Rnf138
Name: ring finger protein 138
Synonyms: Trif-d, 2810480D20Rik, 2410015A17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56515
VEGA: 18
Homologene: 9446
Snai2
Name: snail family zinc finger 2
Synonyms: Slugh, Slug, Snail2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20583
VEGA: 16
Homologene: 31127
Gabra4
Name: gamma-aminobutyric acid type A receptor subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Cox6a1
Name: cytochrome c oxidase subunit 6A1
Synonyms: VIaL, subunit VIaL (liver-type)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12861
HGNC: HGNC:2277
Homologene: 3219
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 52,794,601 bp
  • T to C, chromosome 1 at 64,937,927 bp
  • A to T, chromosome 1 at 126,102,542 bp
  • T to C, chromosome 1 at 135,998,625 bp
  • T to A, chromosome 1 at 151,689,592 bp
  • C to T, chromosome 2 at 32,572,278 bp
  • T to A, chromosome 2 at 32,594,099 bp
  • A to T, chromosome 2 at 66,547,018 bp
  • A to T, chromosome 2 at 77,124,224 bp
  • A to G, chromosome 2 at 128,664,005 bp
  • A to T, chromosome 3 at 83,043,265 bp
  • A to G, chromosome 4 at 55,011,376 bp
  • A to G, chromosome 4 at 56,837,753 bp
  • CTTCCAGAGCCATGGACCCATCTTTTCCA to CTTCCA, chromosome 4 at 134,072,718 bp
  • T to C, chromosome 5 at 71,657,809 bp
  • G to A, chromosome 5 at 115,345,921 bp
  • A to T, chromosome 5 at 140,300,252 bp
  • A to G, chromosome 5 at 150,422,754 bp
  • A to G, chromosome 6 at 4,905,477 bp
  • G to A, chromosome 7 at 6,995,539 bp
  • T to C, chromosome 7 at 10,374,952 bp
  • T to C, chromosome 7 at 19,445,172 bp
  • T to G, chromosome 7 at 24,199,138 bp
  • T to A, chromosome 7 at 100,549,369 bp
  • C to A, chromosome 9 at 15,726,848 bp
  • T to C, chromosome 10 at 100,578,381 bp
  • C to T, chromosome 11 at 75,670,030 bp
  • A to G, chromosome 11 at 78,468,676 bp
  • T to C, chromosome 11 at 102,206,630 bp
  • T to G, chromosome 12 at 24,608,433 bp
  • T to C, chromosome 13 at 26,769,247 bp
  • T to A, chromosome 13 at 60,751,147 bp
  • C to A, chromosome 14 at 30,937,843 bp
  • T to C, chromosome 16 at 14,708,286 bp
  • T to A, chromosome 17 at 23,815,692 bp
  • T to C, chromosome 17 at 24,513,374 bp
  • C to A, chromosome 17 at 34,214,032 bp
  • T to A, chromosome 18 at 21,010,734 bp
  • T to C, chromosome 19 at 12,108,685 bp
  • C to A, chromosome X at 93,746,364 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4682 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041934-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.