Strain Name:
B6;129S6-Rr35tm1.1Lap/Mmnc
Stock Number:
042087-UNC
Citation ID:
RRID:MMRRC_042087-UNC
Other Names:
mm771 deletion, mm771 knockout

Strain Information

Rr35tm1.1Lap
Name: regulatory region 35; targeted mutation 1.1, Len Pennacchio
Synonyms: mm771tm1.1Lap
Type: DNA Segment
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Targeted Mutation
Rr35
Name: regulatory region 35
Synonyms: mm771
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
Alteration at locus: Targeted Mutation
Genetic Alterations
Deletion of a 350-bp segment on mouse chromosome 14, identified as a heart enhancer (referred to as "mm771"). 
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • ES Cell Line
    W4 derived from 129S6/SvEvTac
    Phenotype

    Homozygous: Mice homozygous for mm771 enhancer deletion show no gross abnormalities or overt impairments of health and are born at normal Mendelian frequencies. Adult homozygous null females have 5-10% lower body weight than wild-type females (P < 0.05) , but mm771 deletion males show no growth phenotypes. In embryonic homozygous mm771 deletion mouse hearts, Myh7 gene expression is down regulated by ~85% compared to wild-type mice, and the Myh7 protein levels are ~30% of normal. Homozygous null mice show heart myocardiocyte disarray and a modest but significant decrease in fractional shortening and in ejection fraction of the heart, as measured by echocardiography.

    Heterozygous: Adult heterozygous mm771 females have 5-10% lower body weight than wild-type females (P < 0.05) but mm771 enhancer deletion males do not show any growth phenotypes. Myh7 gene expression is reduced by 35% in heterozygotes compared to wild type litter mates. Protein levels and cardiac function have not been assessed in heterozygotes to date.

    MeSH Terms
    • Animals
    • Echocardiography
    • Enhancer Elements, Genetic
    • Epigenomics
    • Female
    • Gene Expression Profiling
    • Gene Expression Regulation
    • Gene Expression Regulation, Developmental
    • Genome, Human
    • Heart/physiology
    • Histones/metabolism
    • Humans
    • Male
    • Mice
    • Mice, Inbred C57BL
    • Mice, Knockout
    • Mutation
    • Phenotype
    Strain Development
    Homology arms were generated by PCR amplification from 129Sv mouse genomic DNA and cloned into targeting vector containing a Neo cassette flanked by loxP sites. The vector was electroporated into W4 mouse ES cells, which were then screened for proper integration. Correctly targeted ES cells were transfected with a plasmid driving a Cre recombinase to remove the Neo cassette leaving a single loxP site in place of the mm771 enhancer. The resulting ES cells were transferred to blastocysts to create chimeras, which were then backcrossed into C57BL/6. Agouti offspring were tested for germline transmission of the targeted allele by PCR with primers specific to vector sequence replacing the enhancer (Bam5'-F: TTGGCTGGACGTAAACTCCTCTTCAG) and genomic sequence outside short arm (mm771.rev: CCAGATTGCCCACTTTTAAGAATATGCATAC). Heterozygous animals were then intercrossed to obtain homozygous deletion animals for the mouse mm771 locus. Offspring were genotyped with primers covering the mm771 deleted interval mm771.fwd2: TGTCCAGCTGATTGTAGCAGTGGAC mm771.rev2: CACGCTCAGTTCTCCTTTAGTTCAAG).
    Suggested Control Mice
    Wild-type littermates
    MMRRC Genetic QC Summary
    The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.
    • Cardiovascular
    • Models for Human Disease
    • Research Tools
    Donor
    Visel [Ph.D.], Axel
    Primary Reference

    Dickel DE, Barozzi I, Zhu Y, Fukuda-Yuzawa Y, Osterwalder M, Mannion BJ, May D, Spurrell CH, Plajzer-Frick I, Pickle CS, Lee E, Garvin TH, Kato M, Akiyama JA, Afzal V, Lee AY, Gorkin DU, Ren B, Rubin EM, Visel A, Pennacchio LA. Genome-wide compendium and functional assessment of in vivo heart enhancers. Nat Commun. 2016 Oct 5;7:12923. doi: 10.1038/ncomms12923. (Medline PMID: 27703156)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Agouti and black
    MMRRC Breeding System
    Sib-mating
    Generation
    F4
    Overall Breeding Performance
    Good
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Undetermined
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: Undetermined Undetermined
    Average litter size
    5-9
    Recommended wean age
    3 weeks

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    042087-UNC-SPERM Cryo-preserved spermatozoa $564.00 / Non-Profit Aliquot Approximate quantity3
    042087-UNC-RESUS Litter recovered from cryo-archive $2,914.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.