Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
Homozygous: Same as Wild-type
Hemizygous: Same as Wild-type
The tTa construct was inserted into the α-MHC promoter cassette. A responder minimal promoter that was copy number dependent and chromosomal integration site independent was derived from the mouse α-MHC sequences. Two thyroid response elements (TREs) at positions 4217 to 4240 (TRE1) and 4251 to 4267 (TRE2)25,26 and 3 GATA sites at positions 2455,27 4106, and 411428 were destroyed to create the basal promoter. To provide a binding site for the transactivator, an ≈300-bp fragment consisting of 7 repeats of the sequence TCGAGTTTACCACTCCCTA TCAGTGATAGAGAAAAGTGAAAG was inserted after base 4281, 57 bp upstream from the TATA element (Figure 3A). The ELC atrial isoform (ELC1a) or a constitutively active form of mouse glycogen synthase kinase-3β (GSK-3β) was linked to the responder promoter to determine its ability to drive high levels of TG protein expression on induction. The human growth hormone polyadenylation site (hGH polyA) was placed downstream from all cDNAs. All constructs were digested free of the vector sequence with NotI, purified from agarose, and used to generate transgenic mice.
Colony Surveillance Program and Current Health Reports
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
TET-System Technology (tetracycline; US 5,814,618; 5,859,310; 7,541,446; 8,383,364 and European Patent EP 0804565)
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.