Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR2507Btlr/Mmmh
Stock Number:
040413-MU
Citation ID:
RRID:MMRRC_040413-MU
Other Names:
R2507 (G1), C57BL/6J-MtgxR2507Btlr
Major Collection:

Strain Information

B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Gsr
Name: glutathione reductase
Synonyms: Gr-1, Gr1, D8Ertd238e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14782
HGNC: HGNC:4623
Homologene: 531
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Thop1
Name: thimet oligopeptidase 1
Synonyms: EP24.15
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 50492
Homologene: 55726
Jam2
Name: junction adhesion molecule 2
Synonyms: 2410030G21Rik, JAM-2, VE-JAM, 2410167M24Rik, Jcam2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67374
Homologene: 10929
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,011,909 bp
  • T to C, chromosome 1 at 34,188,417 bp
  • A to G, chromosome 1 at 44,001,449 bp
  • A to G, chromosome 1 at 66,612,107 bp
  • G to A, chromosome 1 at 69,539,288 bp
  • A to G, chromosome 1 at 72,261,976 bp
  • A to T, chromosome 1 at 84,583,080 bp
  • A to G, chromosome 1 at 92,511,378 bp
  • A to G, chromosome 1 at 150,392,944 bp
  • T to C, chromosome 2 at 29,207,519 bp
  • T to C, chromosome 2 at 94,429,817 bp
  • G to A, chromosome 2 at 101,886,331 bp
  • A to G, chromosome 2 at 119,780,054 bp
  • A to G, chromosome 2 at 122,333,138 bp
  • A to T, chromosome 2 at 127,801,423 bp
  • A to G, chromosome 2 at 129,801,515 bp
  • T to A, chromosome 2 at 167,306,638 bp
  • T to A, chromosome 2 at 169,962,595 bp
  • T to C, chromosome 2 at 172,370,445 bp
  • T to C, chromosome 3 at 29,956,299 bp
  • T to C, chromosome 3 at 114,138,392 bp
  • A to T, chromosome 3 at 154,698,659 bp
  • A to T, chromosome 4 at 19,553,871 bp
  • A to T, chromosome 4 at 62,191,256 bp
  • T to A, chromosome 4 at 88,629,211 bp
  • T to A, chromosome 4 at 96,754,189 bp
  • T to C, chromosome 4 at 118,933,925 bp
  • C to G, chromosome 5 at 25,247,612 bp
  • T to C, chromosome 5 at 63,791,437 bp
  • T to C, chromosome 5 at 64,925,296 bp
  • T to A, chromosome 5 at 65,790,061 bp
  • C to T, chromosome 5 at 72,619,061 bp
  • A to G, chromosome 5 at 137,607,051 bp
  • C to A, chromosome 5 at 150,756,428 bp
  • C to T, chromosome 6 at 34,310,064 bp
  • C to A, chromosome 6 at 57,361,259 bp
  • T to C, chromosome 6 at 113,647,678 bp
  • A to G, chromosome 6 at 128,673,982 bp
  • A to G, chromosome 7 at 47,235,494 bp
  • T to C, chromosome 7 at 104,228,185 bp
  • C to A, chromosome 7 at 109,140,641 bp
  • A to G, chromosome 7 at 128,178,065 bp
  • T to G, chromosome 8 at 33,680,288 bp
  • T to C, chromosome 8 at 61,043,228 bp
  • CGAGGAGGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA, chromosome 8 at 83,998,996 bp
  • G to C, chromosome 8 at 86,534,865 bp
  • C to T, chromosome 8 at 91,033,987 bp
  • T to C, chromosome 8 at 95,343,124 bp
  • T to A, chromosome 8 at 120,673,290 bp
  • A to G, chromosome 8 at 125,939,938 bp
  • T to C, chromosome 9 at 20,470,431 bp
  • T to C, chromosome 9 at 21,489,807 bp
  • T to C, chromosome 9 at 41,157,354 bp
  • G to A, chromosome 9 at 65,301,977 bp
  • T to C, chromosome 9 at 82,915,339 bp
  • T to A, chromosome 9 at 86,513,117 bp
  • T to C, chromosome 9 at 108,116,114 bp
  • A to G, chromosome 9 at 110,037,483 bp
  • A to G, chromosome 10 at 21,621,782 bp
  • A to G, chromosome 10 at 24,910,813 bp
  • C to T, chromosome 10 at 52,353,326 bp
  • T to G, chromosome 10 at 81,070,264 bp
  • A to G, chromosome 10 at 99,109,286 bp
  • T to C, chromosome 11 at 5,541,360 bp
  • A to T, chromosome 11 at 57,289,320 bp
  • G to A, chromosome 11 at 82,940,137 bp
  • G to A, chromosome 11 at 115,271,980 bp
  • T to C, chromosome 11 at 116,155,426 bp
  • A to C, chromosome 12 at 11,092,086 bp
  • T to C, chromosome 12 at 33,038,915 bp
  • G to A, chromosome 12 at 55,718,201 bp
  • T to A, chromosome 12 at 65,057,815 bp
  • G to A, chromosome 12 at 71,975,223 bp
  • A to G, chromosome 12 at 76,217,099 bp
  • T to A, chromosome 12 at 111,627,242 bp
  • A to G, chromosome 13 at 30,882,365 bp
  • T to G, chromosome 13 at 63,524,959 bp
  • T to C, chromosome 13 at 71,959,820 bp
  • A to T, chromosome 13 at 100,771,236 bp
  • A to G, chromosome 15 at 13,041,361 bp
  • A to T, chromosome 15 at 43,511,698 bp
  • A to G, chromosome 15 at 89,419,098 bp
  • G to A, chromosome 15 at 98,066,745 bp
  • G to A, chromosome 16 at 84,806,953 bp
  • A to T, chromosome 17 at 20,993,848 bp
  • T to A, chromosome 17 at 23,674,078 bp
  • A to T, chromosome 18 at 34,316,537 bp
  • T to A, chromosome 18 at 56,586,884 bp
  • T to G, chromosome X at 7,626,448 bp
  • T to G, chromosome X at 134,695,379 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2507 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040413-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.