Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR3773Btlr/Mmmh
Stock Number:
040749-MU
Citation ID:
RRID:MMRRC_040749-MU
Other Names:
R3773 (G1), C57BL/6J-MtgxR3773Btlr
Major Collection:

Strain Information

Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Matk
Name: megakaryocyte-associated tyrosine kinase
Synonyms: Ntk, HYL, CHK, Csk homologous kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17179
HGNC: HGNC:6906
Homologene: 48104
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,421,810 bp
  • G to T, chromosome 1 at 152,756,805 bp
  • A to T, chromosome 1 at 161,843,996 bp
  • A to T, chromosome 2 at 4,590,622 bp
  • A to T, chromosome 2 at 28,840,869 bp
  • C to T, chromosome 2 at 31,360,896 bp
  • A to T, chromosome 2 at 36,640,321 bp
  • T to C, chromosome 2 at 62,263,943 bp
  • T to C, chromosome 2 at 66,483,648 bp
  • T to C, chromosome 2 at 76,771,367 bp
  • T to G, chromosome 2 at 113,582,118 bp
  • C to T, chromosome 2 at 145,860,446 bp
  • T to C, chromosome 2 at 147,061,287 bp
  • A to G, chromosome 3 at 83,898,586 bp
  • T to G, chromosome 3 at 90,119,894 bp
  • T to C, chromosome 4 at 33,330,889 bp
  • C to T, chromosome 4 at 91,264,088 bp
  • C to T, chromosome 4 at 135,555,847 bp
  • C to T, chromosome 4 at 136,227,575 bp
  • T to C, chromosome 4 at 148,044,450 bp
  • T to C, chromosome 5 at 52,582,746 bp
  • A to G, chromosome 5 at 87,424,095 bp
  • A to G, chromosome 5 at 103,477,121 bp
  • G to A, chromosome 5 at 108,582,672 bp
  • A to G, chromosome 5 at 139,238,820 bp
  • A to T, chromosome 5 at 150,398,198 bp
  • T to A, chromosome 6 at 66,553,367 bp
  • C to T, chromosome 6 at 76,496,959 bp
  • T to A, chromosome 6 at 115,785,217 bp
  • T to C, chromosome 6 at 118,126,219 bp
  • C to T, chromosome 6 at 120,002,280 bp
  • T to A, chromosome 6 at 128,555,083 bp
  • T to A, chromosome 6 at 137,443,594 bp
  • T to C, chromosome 6 at 141,972,335 bp
  • C to A, chromosome 7 at 5,544,711 bp
  • T to C, chromosome 7 at 24,295,981 bp
  • T to C, chromosome 7 at 46,889,615 bp
  • A to T, chromosome 7 at 96,694,880 bp
  • C to T, chromosome 7 at 105,741,918 bp
  • A to T, chromosome 8 at 87,780,512 bp
  • A to T, chromosome 9 at 20,473,117 bp
  • T to C, chromosome 9 at 42,330,996 bp
  • C to A, chromosome 9 at 57,140,377 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • G to A, chromosome 10 at 9,768,927 bp
  • T to A, chromosome 10 at 75,439,838 bp
  • G to A, chromosome 10 at 79,035,180 bp
  • T to A, chromosome 10 at 81,258,297 bp
  • C to A, chromosome 10 at 81,272,609 bp
  • A to G, chromosome 11 at 3,975,548 bp
  • T to C, chromosome 11 at 69,916,101 bp
  • C to T, chromosome 11 at 70,679,515 bp
  • G to A, chromosome 13 at 55,246,673 bp
  • G to A, chromosome 13 at 55,534,480 bp
  • A to G, chromosome 13 at 63,841,450 bp
  • G to A, chromosome 13 at 81,499,043 bp
  • C to T, chromosome 14 at 57,810,077 bp
  • T to C, chromosome 14 at 79,567,210 bp
  • A to T, chromosome 15 at 21,578,554 bp
  • A to G, chromosome 15 at 27,748,091 bp
  • A to G, chromosome 15 at 76,853,636 bp
  • A to G, chromosome 15 at 82,182,108 bp
  • A to T, chromosome 15 at 84,406,685 bp
  • T to C, chromosome 15 at 88,780,847 bp
  • A to G, chromosome 15 at 103,444,391 bp
  • T to C, chromosome 16 at 18,256,775 bp
  • A to G, chromosome 17 at 12,701,205 bp
  • A to G, chromosome 17 at 17,374,651 bp
  • A to G, chromosome 17 at 19,589,657 bp
  • T to A, chromosome 17 at 25,943,393 bp
  • G to T, chromosome 17 at 37,086,065 bp
  • T to C, chromosome 17 at 56,428,978 bp
  • T to C, chromosome 17 at 56,876,262 bp
  • T to A, chromosome 17 at 74,618,429 bp
  • T to C, chromosome 17 at 78,959,106 bp
  • T to C, chromosome 18 at 20,591,862 bp
  • T to A, chromosome 18 at 37,475,890 bp
  • G to A, chromosome 19 at 3,612,330 bp
  • T to A, chromosome 19 at 13,795,204 bp
  • G to T, chromosome 19 at 23,572,553 bp
  • T to G, chromosome 19 at 46,669,723 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040749-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.