Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7348Btlr/Mmmh
Stock Number:
045380-MU
Citation ID:
RRID:MMRRC_045380-MU
Other Names:
R7348 (G1)
Major Collection:

Strain Information

S1pr1
Name: sphingosine-1-phosphate receptor 1
Synonyms: S1P1, S1P, Edg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13609
HGNC: HGNC:3165
Homologene: 1071
Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Ap4e1
Name: adaptor-related protein complex AP-4, epsilon 1
Synonyms: 2310033A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108011
HGNC: HGNC:573
Homologene: 22397
Bmp6
Name: bone morphogenetic protein 6
Synonyms: Vgr1, D13Wsu115e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12161
VEGA: 13
HGNC: HGNC:1073
Homologene: 1300
Slc6a5
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 5
Synonyms: Glyt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 104245
Homologene: 37901
Pygb
Name: brain glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110078
HGNC: HGNC:9723
Homologene: 100930
Agtrap
Name: angiotensin II, type I receptor-associated protein
Synonyms: Atrap, D4Wsu124e, 3300002E14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11610
Homologene: 7621
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 73,916,917 bp
  • A to G, chromosome 1 at 172,102,223 bp
  • CTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG to CTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG, chromosome 1 at 173,729,196 bp
  • T to C, chromosome 2 at 51,628,402 bp
  • A to T, chromosome 2 at 127,061,976 bp
  • G to T, chromosome 2 at 127,061,977 bp
  • A to G, chromosome 2 at 130,615,135 bp
  • A to C, chromosome 2 at 130,616,439 bp
  • A to T, chromosome 2 at 131,212,652 bp
  • T to C, chromosome 2 at 140,265,724 bp
  • C to T, chromosome 2 at 150,786,983 bp
  • G to T, chromosome 2 at 160,782,118 bp
  • A to G, chromosome 3 at 9,474,598 bp
  • A to G, chromosome 3 at 33,832,676 bp
  • A to G, chromosome 3 at 115,712,061 bp
  • A to T, chromosome 3 at 148,817,766 bp
  • T to G, chromosome 4 at 48,051,290 bp
  • T to C, chromosome 4 at 92,147,218 bp
  • C to A, chromosome 4 at 96,444,640 bp
  • T to C, chromosome 4 at 112,021,573 bp
  • T to A, chromosome 4 at 114,244,722 bp
  • T to C, chromosome 4 at 128,777,217 bp
  • G to T, chromosome 4 at 148,080,597 bp
  • C to A, chromosome 4 at 149,983,902 bp
  • T to C, chromosome 5 at 30,861,829 bp
  • T to C, chromosome 5 at 139,814,054 bp
  • T to C, chromosome 6 at 42,744,856 bp
  • G to C, chromosome 6 at 72,616,278 bp
  • A to G, chromosome 6 at 118,508,564 bp
  • G to T, chromosome 6 at 134,450,818 bp
  • G to A, chromosome 7 at 4,921,818 bp
  • G to A, chromosome 7 at 19,524,416 bp
  • A to T, chromosome 7 at 21,053,452 bp
  • A to G, chromosome 7 at 24,978,826 bp
  • A to G, chromosome 7 at 26,444,273 bp
  • A to G, chromosome 7 at 27,157,251 bp
  • G to T, chromosome 7 at 30,656,966 bp
  • G to A, chromosome 7 at 35,429,928 bp
  • T to C, chromosome 7 at 47,335,409 bp
  • A to T, chromosome 7 at 49,910,167 bp
  • T to C, chromosome 7 at 108,256,123 bp
  • T to C, chromosome 7 at 108,317,713 bp
  • T to C, chromosome 8 at 67,790,931 bp
  • T to C, chromosome 8 at 112,665,277 bp
  • T to A, chromosome 8 at 114,472,652 bp
  • A to G, chromosome 9 at 49,030,877 bp
  • A to G, chromosome 9 at 59,313,786 bp
  • T to C, chromosome 9 at 59,486,058 bp
  • A to G, chromosome 9 at 62,849,176 bp
  • T to C, chromosome 9 at 119,535,833 bp
  • T to C, chromosome 10 at 4,374,574 bp
  • A to G, chromosome 10 at 12,748,018 bp
  • A to G, chromosome 10 at 78,917,562 bp
  • G to T, chromosome 10 at 86,750,348 bp
  • C to T, chromosome 10 at 110,780,975 bp
  • C to A, chromosome 11 at 67,202,539 bp
  • T to A, chromosome 11 at 79,536,850 bp
  • C to A, chromosome 11 at 121,594,311 bp
  • G to T, chromosome 12 at 85,267,441 bp
  • T to C, chromosome 13 at 38,485,903 bp
  • T to A, chromosome 13 at 68,734,675 bp
  • T to C, chromosome 13 at 76,182,884 bp
  • C to T, chromosome 14 at 21,003,150 bp
  • T to A, chromosome 14 at 21,008,952 bp
  • C to T, chromosome 14 at 27,500,336 bp
  • G to A, chromosome 14 at 32,250,079 bp
  • A to T, chromosome 14 at 54,952,259 bp
  • G to A, chromosome 15 at 41,866,159 bp
  • C to A, chromosome 16 at 7,408,024 bp
  • T to G, chromosome 16 at 18,815,885 bp
  • C to A, chromosome 16 at 26,516,827 bp
  • A to G, chromosome 17 at 12,703,484 bp
  • A to T, chromosome 17 at 46,510,993 bp
  • A to G, chromosome 17 at 50,004,323 bp
  • T to A, chromosome 18 at 4,340,561 bp
  • A to G, chromosome 18 at 25,090,467 bp
  • G to A, chromosome 18 at 35,980,336 bp
  • G to A, chromosome 19 at 11,590,073 bp
  • A to T, chromosome 19 at 17,456,818 bp
  • A to G, chromosome 19 at 45,572,466 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7348 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045380-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.