Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7296Btlr/Mmmh
Stock Number:
045400-MU
Citation ID:
RRID:MMRRC_045400-MU
Other Names:
R7296 (G1)
Major Collection:

Strain Information

Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
B4galt6
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56386
VEGA: 18
HGNC: HGNC:929
Homologene: 3506
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Hgf
Name: hepatocyte growth factor
Synonyms: scatter factor, NK1, SF/HGF, HGF/SF, NK2, C230052L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 37,614,618 bp
  • T to A, chromosome 1 at 44,060,916 bp
  • T to A, chromosome 1 at 57,383,143 bp
  • T to A, chromosome 1 at 60,310,224 bp
  • T to C, chromosome 1 at 90,827,986 bp
  • T to C, chromosome 1 at 180,696,958 bp
  • T to C, chromosome 2 at 32,922,642 bp
  • T to A, chromosome 2 at 69,482,381 bp
  • G to C, chromosome 2 at 71,506,785 bp
  • G to T, chromosome 2 at 76,671,764 bp
  • T to A, chromosome 2 at 87,575,708 bp
  • C to A, chromosome 2 at 89,124,836 bp
  • C to A, chromosome 2 at 92,458,739 bp
  • G to A, chromosome 2 at 112,250,056 bp
  • A to G, chromosome 2 at 132,252,877 bp
  • A to G, chromosome 2 at 153,715,026 bp
  • A to G, chromosome 2 at 164,900,132 bp
  • T to C, chromosome 2 at 165,840,009 bp
  • T to C, chromosome 2 at 167,974,772 bp
  • A to G, chromosome 2 at 180,260,336 bp
  • C to A, chromosome 3 at 38,889,145 bp
  • C to T, chromosome 3 at 82,021,076 bp
  • A to G, chromosome 4 at 129,225,418 bp
  • A to G, chromosome 4 at 138,395,841 bp
  • T to A, chromosome 5 at 16,564,843 bp
  • G to A, chromosome 5 at 110,237,724 bp
  • T to C, chromosome 5 at 121,861,256 bp
  • A to C, chromosome 6 at 42,215,439 bp
  • A to G, chromosome 6 at 84,106,898 bp
  • G to A, chromosome 6 at 87,646,215 bp
  • A to G, chromosome 6 at 88,084,637 bp
  • T to G, chromosome 6 at 113,147,557 bp
  • T to A, chromosome 6 at 122,528,422 bp
  • T to A, chromosome 6 at 129,831,592 bp
  • G to A, chromosome 6 at 142,671,593 bp
  • G to A, chromosome 6 at 146,822,134 bp
  • T to A, chromosome 7 at 42,136,402 bp
  • A to T, chromosome 7 at 119,786,516 bp
  • G to A, chromosome 7 at 120,278,311 bp
  • A to G, chromosome 7 at 131,112,132 bp
  • A to T, chromosome 7 at 140,336,741 bp
  • G to T, chromosome 8 at 106,210,489 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to C, chromosome 9 at 21,019,015 bp
  • A to C, chromosome 9 at 32,322,749 bp
  • T to C, chromosome 9 at 79,682,066 bp
  • T to G, chromosome 9 at 99,620,282 bp
  • G to T, chromosome 9 at 108,574,585 bp
  • C to A, chromosome 9 at 109,382,075 bp
  • A to G, chromosome 9 at 110,861,289 bp
  • G to A, chromosome 9 at 122,379,573 bp
  • T to A, chromosome 10 at 26,282,830 bp
  • T to A, chromosome 10 at 82,061,237 bp
  • A to G, chromosome 10 at 88,770,724 bp
  • T to A, chromosome 10 at 94,044,047 bp
  • C to A, chromosome 10 at 94,139,881 bp
  • T to C, chromosome 10 at 128,085,522 bp
  • G to A, chromosome 11 at 60,188,673 bp
  • G to T, chromosome 11 at 120,091,708 bp
  • T to A, chromosome 12 at 28,594,715 bp
  • C to T, chromosome 12 at 51,785,852 bp
  • T to A, chromosome 12 at 76,103,036 bp
  • T to C, chromosome 12 at 79,278,372 bp
  • C to T, chromosome 12 at 113,545,572 bp
  • C to T, chromosome 13 at 22,475,339 bp
  • A to T, chromosome 13 at 33,093,827 bp
  • A to G, chromosome 13 at 35,863,395 bp
  • G to T, chromosome 13 at 68,568,860 bp
  • A to C, chromosome 13 at 114,857,394 bp
  • T to C, chromosome 14 at 54,990,025 bp
  • G to T, chromosome 15 at 82,617,235 bp
  • A to T, chromosome 15 at 84,855,717 bp
  • T to A, chromosome 15 at 101,850,629 bp
  • T to C, chromosome 16 at 3,963,590 bp
  • T to C, chromosome 16 at 18,234,926 bp
  • T to A, chromosome 16 at 59,915,838 bp
  • C to T, chromosome 16 at 72,989,631 bp
  • T to C, chromosome 16 at 93,583,942 bp
  • T to A, chromosome 17 at 21,433,582 bp
  • A to G, chromosome 17 at 34,743,659 bp
  • T to C, chromosome 17 at 71,790,001 bp
  • T to G, chromosome 18 at 6,626,385 bp
  • A to T, chromosome 18 at 20,728,042 bp
  • A to G, chromosome 18 at 35,653,299 bp
  • A to T, chromosome 18 at 57,275,753 bp
  • A to G, chromosome 18 at 61,258,293 bp
  • T to A, chromosome 19 at 25,184,881 bp
  • G to A, chromosome 19 at 29,584,578 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7296 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045400-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.