Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7330Btlr/Mmmh
Stock Number:
045423-MU
Citation ID:
RRID:MMRRC_045423-MU
Other Names:
R7330 (G1)
Major Collection:

Strain Information

Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Actr2
Name: actin related protein 2
Synonyms: 4921510D23Rik, D6Ertd746e, Arp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66713
HGNC: HGNC:169
Homologene: 4181
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 28,812,935 bp
  • T to A, chromosome 2 at 36,735,045 bp
  • C to T, chromosome 2 at 52,189,703 bp
  • C to T, chromosome 2 at 76,917,011 bp
  • C to A, chromosome 2 at 88,024,921 bp
  • G to A, chromosome 2 at 131,172,733 bp
  • T to A, chromosome 3 at 94,939,710 bp
  • C to A, chromosome 4 at 32,723,685 bp
  • T to A, chromosome 4 at 141,308,453 bp
  • A to G, chromosome 4 at 141,410,612 bp
  • T to A, chromosome 5 at 76,606,745 bp
  • A to G, chromosome 5 at 117,370,762 bp
  • T to A, chromosome 5 at 134,606,787 bp
  • A to G, chromosome 6 at 48,475,462 bp
  • A to G, chromosome 6 at 53,974,759 bp
  • C to T, chromosome 6 at 69,227,103 bp
  • G to A, chromosome 6 at 108,438,331 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • A to AAGTAC, chromosome 6 at 113,399,164 bp
  • A to G, chromosome 6 at 125,162,937 bp
  • A to G, chromosome 7 at 3,639,855 bp
  • T to A, chromosome 7 at 25,001,152 bp
  • T to C, chromosome 7 at 125,703,883 bp
  • G to T, chromosome 7 at 135,528,469 bp
  • A to G, chromosome 8 at 47,192,236 bp
  • C to A, chromosome 8 at 86,631,394 bp
  • T to A, chromosome 8 at 94,087,405 bp
  • T to A, chromosome 9 at 19,249,271 bp
  • A to G, chromosome 9 at 64,288,226 bp
  • A to T, chromosome 9 at 65,280,245 bp
  • G to T, chromosome 9 at 97,461,369 bp
  • A to T, chromosome 9 at 107,791,045 bp
  • A to G, chromosome 9 at 108,045,253 bp
  • T to C, chromosome 9 at 119,148,382 bp
  • T to C, chromosome 10 at 5,128,434 bp
  • T to G, chromosome 10 at 58,610,554 bp
  • GAA to GA, chromosome 10 at 88,787,562 bp
  • C to T, chromosome 10 at 129,046,464 bp
  • T to C, chromosome 11 at 3,346,311 bp
  • A to T, chromosome 11 at 20,072,544 bp
  • G to T, chromosome 11 at 23,490,558 bp
  • C to G, chromosome 11 at 73,027,047 bp
  • A to T, chromosome 11 at 93,882,073 bp
  • A to G, chromosome 11 at 105,986,061 bp
  • T to A, chromosome 12 at 29,851,554 bp
  • A to G, chromosome 12 at 102,775,712 bp
  • A to T, chromosome 13 at 3,941,216 bp
  • A to G, chromosome 13 at 22,102,541 bp
  • T to G, chromosome 13 at 74,375,034 bp
  • T to A, chromosome 13 at 91,741,532 bp
  • T to A, chromosome 13 at 112,493,651 bp
  • G to A, chromosome 15 at 23,226,950 bp
  • T to C, chromosome 15 at 31,451,203 bp
  • G to T, chromosome 15 at 59,333,667 bp
  • G to A, chromosome 15 at 68,212,751 bp
  • A to G, chromosome 15 at 98,894,410 bp
  • TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC to TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC, chromosome 16 at 91,656,598 bp
  • T to C, chromosome 17 at 18,106,167 bp
  • C to T, chromosome 17 at 27,434,824 bp
  • T to A, chromosome 17 at 34,730,472 bp
  • T to C, chromosome 18 at 37,768,386 bp
  • T to A, chromosome 18 at 84,014,831 bp
  • A to G, chromosome 19 at 39,689,190 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7330 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045423-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.