Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7966Btlr/Mmmh
Stock Number:
046009-MU
Citation ID:
RRID:MMRRC_046009-MU
Other Names:
R7966 (G1)
Major Collection:

Strain Information

Olig2
Name: oligodendrocyte transcription factor 2
Synonyms: RK17, Olg-2, Bhlhb1, bHLHe19
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50913
HGNC: HGNC:9398
Homologene: 4241
Lig3
Name: ligase III, DNA, ATP-dependent
Synonyms: D11Wsu78e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16882
HGNC: HGNC:6600
Homologene: 32109
Prpf4b
Name: pre-mRNA processing factor 4B
Synonyms: Prp4, Prpk, Prp4k
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19134
VEGA: 13
Homologene: 134085
Hdac4
Name: histone deacetylase 4
Synonyms: 4932408F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208727
Homologene: 55946
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Tmem242
Name: transmembrane protein 242
Synonyms: 2310046K16Rik, 1110008A10Rik, 5730437N04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70544
Homologene: 44020
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 91,933,680 bp
  • A to T, chromosome 1 at 94,041,461 bp
  • A to G, chromosome 2 at 25,766,377 bp
  • T to C, chromosome 2 at 58,147,932 bp
  • G to C, chromosome 2 at 165,430,235 bp
  • T to A, chromosome 3 at 64,278,814 bp
  • A to T, chromosome 3 at 69,820,953 bp
  • C to A, chromosome 4 at 3,586,215 bp
  • A to T, chromosome 4 at 21,679,932 bp
  • T to A, chromosome 4 at 109,321,143 bp
  • A to G, chromosome 5 at 27,723,372 bp
  • T to C, chromosome 5 at 53,701,238 bp
  • T to C, chromosome 5 at 120,871,899 bp
  • A to G, chromosome 5 at 124,490,502 bp
  • T to A, chromosome 5 at 138,447,571 bp
  • T to C, chromosome 6 at 22,059,954 bp
  • A to T, chromosome 6 at 40,926,088 bp
  • T to C, chromosome 6 at 55,379,098 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • T to A, chromosome 6 at 125,639,341 bp
  • A to G, chromosome 7 at 6,066,323 bp
  • T to A, chromosome 7 at 45,268,053 bp
  • A to G, chromosome 7 at 85,411,554 bp
  • T to C, chromosome 7 at 102,535,416 bp
  • A to T, chromosome 7 at 103,172,855 bp
  • A to G, chromosome 7 at 120,182,700 bp
  • G to T, chromosome 8 at 45,332,917 bp
  • A to G, chromosome 9 at 38,816,240 bp
  • C to T, chromosome 9 at 40,282,550 bp
  • A to G, chromosome 9 at 42,394,962 bp
  • A to G, chromosome 9 at 55,762,327 bp
  • A to G, chromosome 10 at 5,116,965 bp
  • T to C, chromosome 10 at 6,900,668 bp
  • T to C, chromosome 10 at 22,819,807 bp
  • A to G, chromosome 10 at 60,121,732 bp
  • A to G, chromosome 10 at 79,932,055 bp
  • G to A, chromosome 10 at 81,490,269 bp
  • A to G, chromosome 10 at 84,527,585 bp
  • A to T, chromosome 11 at 67,953,745 bp
  • T to C, chromosome 11 at 82,790,516 bp
  • A to T, chromosome 12 at 71,173,129 bp
  • A to T, chromosome 13 at 21,142,186 bp
  • A to C, chromosome 13 at 24,893,423 bp
  • A to G, chromosome 13 at 34,901,445 bp
  • T to C, chromosome 13 at 67,199,238 bp
  • T to C, chromosome 15 at 57,821,667 bp
  • A to T, chromosome 15 at 64,702,090 bp
  • T to C, chromosome 16 at 64,784,876 bp
  • T to A, chromosome 16 at 72,983,872 bp
  • AGCCGCCGCCGCCGCCGCAGCCGCCGCCGCCGC to AGCCGCCGCCGCCGCAGCCGCCGCCGCCGC, chromosome 16 at 91,227,074 bp
  • A to G, chromosome 17 at 5,411,436 bp
  • T to C, chromosome 17 at 27,112,028 bp
  • A to G, chromosome 17 at 49,686,425 bp
  • T to G, chromosome 19 at 4,856,539 bp
  • A to G, chromosome 19 at 17,178,859 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7966 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046009-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.