Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8151Btlr/Mmmh
Stock Number:
067577-MU
Citation ID:
RRID:MMRRC_067577-MU
Other Names:
R8151 (G1)
Major Collection:

Strain Information

Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Polr2d
Name: polymerase (RNA) II (DNA directed) polypeptide D
Synonyms: 2310002G05Rik, HSRBP4, RBP4, 2610028L19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69241
VEGA: 18
HGNC: HGNC:9191
Homologene: 37968
Stx16
Name: syntaxin 16
Synonyms: 5430410K23Rik, SYN16, 6330500A18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228960
Homologene: 2791
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Kras
Name: Kirsten rat sarcoma viral oncogene homolog
Synonyms: Ki-ras, Kras-2, K-ras, Kras2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16653
HGNC: HGNC:6407
Homologene: 37990
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,525,268 bp
  • C to A, chromosome 1 at 157,243,584 bp
  • T to C, chromosome 1 at 173,977,357 bp
  • T to C, chromosome 2 at 162,278,085 bp
  • G to A, chromosome 2 at 170,119,651 bp
  • T to A, chromosome 2 at 174,093,491 bp
  • G to A, chromosome 3 at 38,892,054 bp
  • A to T, chromosome 3 at 85,688,540 bp
  • A to G, chromosome 3 at 96,559,613 bp
  • A to C, chromosome 3 at 109,508,848 bp
  • A to C, chromosome 3 at 116,124,479 bp
  • A to G, chromosome 3 at 135,247,022 bp
  • C to T, chromosome 3 at 153,411,580 bp
  • T to C, chromosome 4 at 123,397,413 bp
  • T to C, chromosome 4 at 139,402,801 bp
  • G to A, chromosome 6 at 48,029,141 bp
  • A to C, chromosome 6 at 112,816,667 bp
  • T to C, chromosome 6 at 121,841,158 bp
  • ACTTCTTCTTCTTCTTCTTC to ACTTCTTCTTCTTCTTC, chromosome 6 at 145,220,634 bp
  • T to C, chromosome 7 at 28,153,341 bp
  • C to T, chromosome 7 at 44,104,363 bp
  • T to A, chromosome 7 at 126,414,306 bp
  • T to C, chromosome 7 at 130,797,095 bp
  • G to A, chromosome 8 at 45,942,793 bp
  • A to G, chromosome 8 at 71,507,981 bp
  • A to G, chromosome 9 at 21,940,809 bp
  • A to G, chromosome 9 at 42,067,933 bp
  • A to G, chromosome 9 at 66,433,791 bp
  • A to T, chromosome 9 at 79,630,549 bp
  • C to A, chromosome 10 at 14,667,953 bp
  • C to T, chromosome 10 at 21,395,566 bp
  • T to C, chromosome 10 at 77,112,584 bp
  • T to C, chromosome 11 at 5,837,906 bp
  • A to T, chromosome 11 at 40,733,702 bp
  • A to G, chromosome 11 at 46,475,895 bp
  • C to A, chromosome 11 at 72,036,758 bp
  • G to A, chromosome 11 at 72,317,700 bp
  • T to C, chromosome 11 at 102,206,468 bp
  • A to G, chromosome 11 at 113,872,857 bp
  • A to G, chromosome 11 at 115,577,933 bp
  • A to G, chromosome 15 at 9,601,512 bp
  • AT to ATT, chromosome 17 at 88,742,249 bp
  • A to G, chromosome 18 at 7,127,358 bp
  • T to A, chromosome 18 at 31,795,312 bp
  • A to G, chromosome 18 at 68,250,572 bp
  • G to T, chromosome 18 at 75,520,105 bp
  • T to C, chromosome 19 at 9,004,679 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8151 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067577-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.