Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8228Btlr/Mmmh
Stock Number:
067661-MU
Citation ID:
RRID:MMRRC_067661-MU
Other Names:
R8228 (G1)
Major Collection:

Strain Information

Col1a1
Name: collagen, type I, alpha 1
Synonyms: Col1a-1, Mov-13, Cola1, Cola-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12842
HGNC: HGNC:2197
Homologene: 73874
Arid5b
Name: AT-rich interaction domain 5B
Synonyms: 5430435G07Rik, Desrt, Mrf2beta, Mrf2alpha, Mrf2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71371
VEGA: 10
Homologene: 45872
Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22036
Homologene: 31343
Iffo2
Name: intermediate filament family orphan 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212632
Homologene: 102202
Alox12b
Name: arachidonate 12-lipoxygenase, 12R type
Synonyms: e-LOX2, Aloxe2, 12R-LOX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11686
HGNC: HGNC:430
Homologene: 884
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TTCTTC to TTCTTCCTCTTC, chromosome 1 at 133,701,721 bp
  • C to A, chromosome 2 at 28,676,129 bp
  • T to A, chromosome 2 at 87,857,940 bp
  • T to A, chromosome 2 at 128,619,917 bp
  • T to C, chromosome 2 at 132,842,794 bp
  • G to A, chromosome 2 at 164,904,898 bp
  • G to T, chromosome 3 at 89,234,948 bp
  • C to G, chromosome 4 at 139,575,172 bp
  • G to A, chromosome 5 at 99,377,121 bp
  • T to C, chromosome 6 at 72,347,517 bp
  • T to C, chromosome 7 at 25,010,508 bp
  • A to T, chromosome 7 at 25,046,310 bp
  • T to C, chromosome 7 at 41,376,836 bp
  • A to G, chromosome 7 at 44,360,305 bp
  • G to A, chromosome 7 at 127,585,007 bp
  • A to G, chromosome 8 at 35,785,838 bp
  • G to A, chromosome 8 at 69,798,919 bp
  • A to T, chromosome 8 at 117,065,775 bp
  • T to C, chromosome 9 at 107,961,066 bp
  • A to G, chromosome 9 at 122,991,976 bp
  • T to C, chromosome 10 at 33,157,018 bp
  • T to A, chromosome 10 at 68,278,706 bp
  • T to C, chromosome 10 at 127,898,675 bp
  • T to A, chromosome 11 at 58,291,555 bp
  • T to C, chromosome 11 at 69,163,929 bp
  • T to G, chromosome 11 at 94,945,600 bp
  • T to C, chromosome 11 at 97,692,039 bp
  • T to C, chromosome 11 at 106,567,171 bp
  • T to C, chromosome 11 at 118,264,890 bp
  • C to A, chromosome 13 at 67,366,414 bp
  • A to G, chromosome 13 at 96,543,215 bp
  • T to C, chromosome 14 at 14,116,843 bp
  • G to T, chromosome 14 at 20,689,907 bp
  • G to A, chromosome 14 at 37,069,191 bp
  • A to G, chromosome 14 at 50,281,540 bp
  • T to C, chromosome 14 at 57,124,469 bp
  • G to T, chromosome 15 at 66,639,940 bp
  • C to T, chromosome 15 at 81,949,210 bp
  • A to G, chromosome 16 at 11,139,090 bp
  • A to G, chromosome 16 at 73,012,880 bp
  • C to T, chromosome 17 at 19,591,022 bp
  • A to G, chromosome 17 at 35,961,041 bp
  • A to G, chromosome 17 at 40,937,328 bp
  • A to T, chromosome 17 at 56,191,129 bp
  • A to G, chromosome 18 at 37,728,183 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG,TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8228 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067661-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.