Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8353Btlr/Mmmh
Stock Number:
067805-MU
Citation ID:
RRID:MMRRC_067805-MU
Other Names:
R8353 (G1)
Major Collection:

Strain Information

Prph
Name: peripherin
Synonyms: Prph1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19132
VEGA: 15
HGNC: HGNC:9461
Homologene: 4559
Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,170,296 bp
  • T to C, chromosome 1 at 130,414,133 bp
  • T to A, chromosome 2 at 26,276,446 bp
  • A to T, chromosome 2 at 31,385,341 bp
  • A to C, chromosome 2 at 52,055,867 bp
  • A to T, chromosome 2 at 70,600,713 bp
  • T to C, chromosome 2 at 79,644,785 bp
  • A to T, chromosome 2 at 91,990,929 bp
  • A to C, chromosome 2 at 120,984,336 bp
  • T to C, chromosome 2 at 122,168,009 bp
  • A to G, chromosome 3 at 89,750,262 bp
  • T to A, chromosome 3 at 107,221,709 bp
  • G to A, chromosome 3 at 108,428,713 bp
  • T to A, chromosome 3 at 116,899,173 bp
  • G to T, chromosome 4 at 46,403,935 bp
  • C to T, chromosome 4 at 61,592,182 bp
  • C to T, chromosome 4 at 101,890,684 bp
  • A to G, chromosome 4 at 103,059,916 bp
  • T to G, chromosome 4 at 123,296,053 bp
  • A to G, chromosome 4 at 126,128,973 bp
  • T to A, chromosome 4 at 126,907,112 bp
  • T to C, chromosome 4 at 130,928,768 bp
  • T to A, chromosome 4 at 137,623,382 bp
  • C to A, chromosome 5 at 34,877,155 bp
  • A to T, chromosome 5 at 90,566,501 bp
  • G to A, chromosome 5 at 98,855,423 bp
  • A to G, chromosome 5 at 111,420,639 bp
  • T to A, chromosome 5 at 151,561,908 bp
  • T to C, chromosome 6 at 30,658,892 bp
  • T to A, chromosome 6 at 60,988,377 bp
  • T to C, chromosome 6 at 83,561,899 bp
  • T to C, chromosome 6 at 87,378,153 bp
  • T to C, chromosome 6 at 121,387,820 bp
  • A to C, chromosome 6 at 124,192,445 bp
  • A to G, chromosome 6 at 147,107,923 bp
  • T to C, chromosome 6 at 148,425,848 bp
  • T to C, chromosome 7 at 4,237,972 bp
  • A to G, chromosome 7 at 5,610,887 bp
  • A to G, chromosome 7 at 10,715,601 bp
  • G to T, chromosome 7 at 19,507,399 bp
  • A to G, chromosome 7 at 27,404,238 bp
  • A to C, chromosome 7 at 35,277,279 bp
  • T to A, chromosome 7 at 104,487,740 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • T to C, chromosome 8 at 4,213,831 bp
  • G to T, chromosome 8 at 33,576,871 bp
  • T to C, chromosome 8 at 55,873,161 bp
  • A to G, chromosome 8 at 68,895,781 bp
  • A to G, chromosome 8 at 71,562,868 bp
  • A to G, chromosome 8 at 95,095,444 bp
  • A to C, chromosome 8 at 105,690,211 bp
  • T to G, chromosome 9 at 7,508,202 bp
  • T to A, chromosome 9 at 27,071,804 bp
  • A to G, chromosome 9 at 46,288,201 bp
  • T to C, chromosome 9 at 50,684,886 bp
  • A to T, chromosome 9 at 56,898,669 bp
  • G to T, chromosome 9 at 66,508,289 bp
  • A to T, chromosome 9 at 86,521,586 bp
  • G to T, chromosome 9 at 101,938,685 bp
  • C to T, chromosome 9 at 106,236,522 bp
  • T to C, chromosome 9 at 107,534,798 bp
  • T to A, chromosome 9 at 108,293,373 bp
  • T to A, chromosome 9 at 108,826,535 bp
  • T to C, chromosome 10 at 5,350,983 bp
  • A to T, chromosome 10 at 9,809,048 bp
  • A to G, chromosome 10 at 11,290,735 bp
  • A to T, chromosome 10 at 21,309,279 bp
  • G to A, chromosome 10 at 23,869,545 bp
  • T to C, chromosome 10 at 30,694,159 bp
  • G to A, chromosome 10 at 111,009,942 bp
  • A to G, chromosome 11 at 5,875,104 bp
  • C to T, chromosome 11 at 22,978,503 bp
  • T to C, chromosome 11 at 51,598,294 bp
  • T to A, chromosome 11 at 57,243,051 bp
  • T to C, chromosome 11 at 58,125,239 bp
  • G to A, chromosome 11 at 59,177,014 bp
  • T to A, chromosome 11 at 69,022,449 bp
  • T to A, chromosome 11 at 70,610,328 bp
  • A to G, chromosome 11 at 73,176,573 bp
  • T to C, chromosome 11 at 76,419,833 bp
  • T to A, chromosome 11 at 105,332,311 bp
  • T to C, chromosome 11 at 120,274,425 bp
  • C to A, chromosome 12 at 31,306,999 bp
  • G to T, chromosome 12 at 33,147,883 bp
  • A to C, chromosome 12 at 51,412,591 bp
  • C to T, chromosome 12 at 87,919,553 bp
  • T to A, chromosome 12 at 101,945,900 bp
  • T to A, chromosome 12 at 103,855,779 bp
  • A to T, chromosome 13 at 9,877,231 bp
  • A to G, chromosome 13 at 43,200,890 bp
  • A to G, chromosome 13 at 56,822,559 bp
  • G to A, chromosome 13 at 92,790,817 bp
  • A to T, chromosome 13 at 112,524,183 bp
  • T to C, chromosome 14 at 24,158,145 bp
  • A to T, chromosome 14 at 31,283,202 bp
  • A to C, chromosome 14 at 32,973,624 bp
  • A to T, chromosome 14 at 53,454,489 bp
  • C to T, chromosome 14 at 67,817,508 bp
  • T to G, chromosome 14 at 72,440,761 bp
  • A to T, chromosome 15 at 47,949,953 bp
  • A to T, chromosome 15 at 59,324,465 bp
  • C to T, chromosome 15 at 74,706,625 bp
  • G to T, chromosome 15 at 76,538,478 bp
  • T to C, chromosome 15 at 82,452,519 bp
  • G to T, chromosome 15 at 89,085,413 bp
  • C to A, chromosome 15 at 90,541,293 bp
  • G to A, chromosome 15 at 99,056,776 bp
  • A to G, chromosome 16 at 8,695,871 bp
  • T to A, chromosome 16 at 14,038,013 bp
  • C to T, chromosome 16 at 20,222,887 bp
  • G to A, chromosome 16 at 29,620,868 bp
  • A to G, chromosome 16 at 31,989,348 bp
  • A to G, chromosome 16 at 45,825,022 bp
  • C to T, chromosome 16 at 49,001,073 bp
  • A to G, chromosome 16 at 56,188,328 bp
  • A to G, chromosome 16 at 96,421,796 bp
  • A to G, chromosome 17 at 7,246,752 bp
  • T to C, chromosome 17 at 14,892,489 bp
  • T to A, chromosome 17 at 28,858,899 bp
  • G to T, chromosome 17 at 36,949,974 bp
  • C to A, chromosome 17 at 46,282,604 bp
  • A to G, chromosome 17 at 48,416,760 bp
  • T to C, chromosome 17 at 57,212,643 bp
  • T to C, chromosome 18 at 77,673,908 bp
  • A to G, chromosome 19 at 5,728,875 bp
  • T to C, chromosome 19 at 29,115,759 bp
  • T to C, chromosome 19 at 29,753,842 bp
  • A to T, chromosome 19 at 47,746,647 bp
  • T to C, chromosome 19 at 53,529,682 bp
  • T to C, chromosome 19 at 56,323,920 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8353 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067805-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.