Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8788Btlr/Mmmh
Stock Number:
068607-MU
Citation ID:
RRID:MMRRC_068607-MU
Other Names:
R8788 (G1)
Major Collection:

Strain Information

Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Slc17a6
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms: 2900073D12Rik, VGLUT2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140919
Homologene: 121617
Uri1
Name: URI1, prefoldin-like chaperone
Synonyms: NNX3, Rmp, C80913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19777
Homologene: 2813
Xrcc6
Name: X-ray repair cross complementing 6
Synonyms: Ku p70, Ku70, G22p1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14375
HGNC: HGNC:4055
Homologene: 37483
Ezr
Name: ezrin
Synonyms: ezrin, p81, cytovillin, Vil2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22350
Homologene: 55740
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,683,762 bp
  • G to A, chromosome 1 at 178,529,525 bp
  • A to T, chromosome 1 at 188,743,619 bp
  • T to C, chromosome 2 at 89,112,282 bp
  • G to T, chromosome 3 at 92,738,230 bp
  • T to C, chromosome 4 at 43,450,185 bp
  • A to G, chromosome 4 at 129,225,950 bp
  • A to G, chromosome 4 at 145,086,735 bp
  • T to C, chromosome 5 at 6,772,635 bp
  • G to T, chromosome 5 at 53,174,806 bp
  • C to T, chromosome 5 at 98,969,980 bp
  • A to G, chromosome 5 at 107,470,987 bp
  • A to G, chromosome 6 at 42,629,538 bp
  • A to T, chromosome 6 at 141,987,844 bp
  • C to A, chromosome 7 at 9,075,483 bp
  • T to C, chromosome 7 at 12,810,563 bp
  • T to C, chromosome 7 at 15,898,574 bp
  • T to A, chromosome 7 at 25,080,391 bp
  • T to C, chromosome 7 at 37,961,578 bp
  • G to A, chromosome 7 at 51,649,160 bp
  • A to G, chromosome 7 at 99,906,554 bp
  • A to G, chromosome 7 at 140,858,893 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to A, chromosome 8 at 115,705,873 bp
  • T to C, chromosome 8 at 122,501,794 bp
  • A to G, chromosome 9 at 6,377,000 bp
  • A to G, chromosome 9 at 7,502,686 bp
  • T to C, chromosome 9 at 21,638,728 bp
  • C to A, chromosome 9 at 59,578,467 bp
  • T to C, chromosome 9 at 72,617,513 bp
  • T to A, chromosome 10 at 60,488,593 bp
  • A to T, chromosome 10 at 69,882,426 bp
  • T to C, chromosome 10 at 127,750,660 bp
  • T to A, chromosome 11 at 49,175,787 bp
  • G to T, chromosome 11 at 55,281,103 bp
  • T to A, chromosome 11 at 79,527,705 bp
  • A to G, chromosome 11 at 87,059,492 bp
  • T to C, chromosome 11 at 115,895,802 bp
  • T to C, chromosome 12 at 64,471,621 bp
  • T to C, chromosome 12 at 105,147,121 bp
  • C to A, chromosome 12 at 111,646,690 bp
  • T to A, chromosome 13 at 100,219,830 bp
  • T to C, chromosome 13 at 118,387,002 bp
  • A to G, chromosome 14 at 18,002,558 bp
  • A to T, chromosome 15 at 47,607,117 bp
  • T to C, chromosome 15 at 58,890,694 bp
  • AGATGATGA to AGATGA, chromosome 15 at 81,851,727 bp
  • C to T, chromosome 15 at 82,027,382 bp
  • C to T, chromosome 15 at 89,301,859 bp
  • A to T, chromosome 16 at 22,939,432 bp
  • A to G, chromosome 16 at 38,787,101 bp
  • T to C, chromosome 17 at 6,753,993 bp
  • A to G, chromosome 17 at 18,451,528 bp
  • G to A, chromosome 18 at 38,283,056 bp
  • T to C, chromosome 19 at 41,121,375 bp
  • C to T, chromosome 19 at 41,585,259 bp
  • T to C, chromosome 19 at 59,169,815 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8788 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068607-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.