Strain Name:
C57BL/6N-Ifngem1Tcf/Mmjax
Stock Number:
071248-JAX
Citation ID:
RRID:MMRRC_071248-JAX
Other Names:
IFNγΔKRKR

Strain Information

Ifngem1Kamm
Name: interferon gamma; endonuclease-mediated mutation 1, Thomas Kammertoens
Synonyms: IfngammadeltaKRKR
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 10
Alteration at locus: CRISPR
Ifng
Name: interferon gamma
Synonyms: Ifg, IFN-gamma
Type: Gene
Species: Mouse
Chromosome: 10
Alteration at locus: CRISPR
NCBI: 15978
VEGA: 10
HGNC: HGNC:5438
Homologene: 55526
Genetic Alterations
These Knock-in mice are lacking a KRKR coding sequence of IFNγ (IFNγΔKRKR) and were generated using CRISPR–Cas9. Two gRNAs (gRNA 1, 5′-ccagcctcaggaagcggaaa-3′; gRNA 2, 5′-cggaatccagcctcaggaag-3′) were chosen for targeting the KRKR sequence (agg and cgg). A 120-nucleotide (nt) repair template introducing the targeted 12-bp deletion was provided for homology-directed repair, spanning 60 nt upstream and downstream of the KRKR coding sequence (5′- caagcattcaatgagctcatccgagtggtccaccagctgttgccggaatccagcctcaggagtcgctgctgattcggggtggggaagagattgtcccaataagaataattctgccagcac-3′).
Genotype Determination
ES Cell Line
Not applicable
Phenotype
The mice have been engineered to have an Interferon-gamma molecule that no longer binds to (herparan sulphate) in the extracellular matrix. The mice are without any pathological phenotype under SPF conditions. However, if they are subjected to a chronic type of infection (e.g. LCMV docile) their systemic IFNg levels double and they succumb to immunopathology.

Conditional phenotype: No

MeSH Terms
  • Mice
  • Animals
  • Cytokines/metabolism
  • Interferon-gamma/metabolism
  • Signal Transduction
  • Neoplasms
  • Extracellular Matrix/metabolism
Strain Development
CRISPR guide(s) and Cas9 protein were microinjected into C57BL/6N zygotes and progeny were screened for the desired mutation; 4 Amino Acid (KRKR) in the C-Terminus (exon 4) of IFNg. Founders were mated to C57BL/6N breeders and derived N1 progeny were identified by PCR and sequencing. N1 mice were then mated again to C57BL/6N breeders to generate N2 mice. N2 heterozygous mutant mice were mated for the production of phenotyping cohorts and further backcrossed two more times to C57BL/6N.
Suggested Control Mice
C57BL/6N
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.
  • Cancer
  • Immunology and Inflammation
  • Virology
Donor
Thomas Kammertoens, Institute of Immunology, Charite Universitätsmedizin, Campus Berlin Buch.
Primary Reference

Kemna J, Gout E, Daniau L, Lao J, Weißert K, Ammann S, Kühn R, Richter M, Molenda C, Sporbert A, Zocholl D, Klopfleisch R, Lortat-Jacob H, Aichele P, Kammertoens T, Blankenstein T. IFNγ binding to extracellular matrix prevents fatal systemic toxicity. Nat Immunol. 2023 Mar;24(3):414-422. doi: 10.1038/s41590-023-01420-5. Epub 2023 Feb 2. Erratum in: Nat Immunol. 2023 Feb 22;: (Medline PMID: 36732425)

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N = 4
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
4 to 6
Recommended wean age
4 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071248-JAX-HOM-F
071248-JAX-HOM-M
071248-JAX-HET-F
071248-JAX-HET-M
071248-JAX-WT-F
071248-JAX-WT-M
Homozygous Female
Homozygous Male
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
$218.00 / Non-Profit Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.