Loading Mouse GIF
Loading...

Strain Name:
B6.Cg-Gt(ROSA)26Sorem3(CAG-ZsGreen1)Jahe/Mmjax
Stock Number:
071742-JAX
Citation ID:
RRID:MMRRC_071742-JAX
Other Names:
Gt(ROSA)26Sor

Strain Information

Gt(ROSA)26Sor
Name: gene trap ROSA 26, Philippe Soriano
Synonyms: ROSA26, beta geo, Gtrgeo26, Gtrosa26, R26, Thumpd3as1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 14910
Genetic Alterations
Removal of the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele (Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze) was performed via CRISPR/Cas genome editing. After activating ZsGreen1 expression, CRISPR/Cas9 targeted ZsGreen1 and inserted a sequence harboring a guide target site and PAMs compatible with A.s and L.b Cas12a, SauCas9, and SpyCas. This insertion suppressed ZsGreen1 chromophore expression by introducing a premature stop codon.
ES Cell Line
Not applicable
Phenotype
Following SpyCas9, SauCas9, or Cas12a mediated CRISPR genome editing, ZsGreen1 fluorescence is restored in target cells.

Conditional phenotype: no

Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
  • Research Tools
Donor
Jason Heaney, Ph.D., Baylor College of Medicine.
Primary Reference
Not ready to publish
Strain Development
CRISPR/Cas9 genome editing removed the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele (Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze) to activate ZsGreen1 expression. Subsequently, CRISPR/Cas9 genome editing in mouse embryos with a guide targeting zsGreen1 [5’ ttgtccgccgccttcatgta (PAM CGG)] and a single-stranded DNA from this seed line was used to introduce sequence harboring a guide target site and PAMs compatible with A.s. and L.b Cas12a, SauCas9, and SpyCas9. HDR was confirmed by PCR genotyping and Sanger sequencing across the target site and donor homology arms. C57BL/6J zygotes harboring Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze were used for generation of the line. Animals were backcrossed to C57BL/6J for 3 generations and subsequently intercrossed and maintained as homozygotes.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Random intra-strain mating
Generation
N/A
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071742-JAX-SPERM Cryo-preserved spermatozoa $459.00 / Non-Profit Aliquot Approximate quantity3
071742-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.