Loading Mouse GIF
Loading...

Strain Name:
C57BL/6-Alx4em1Jian/Mmjax
Stock Number:
071823-JAX
Citation ID:
RRID:MMRRC_071823-JAX
Other Names:
Alx4f/f

Strain Information

Alx4em1Jian
Name: aristaless-like homeobox 4; endonuclease-mediated mutation 1, Rulang Jiang
Synonyms: Alx4f
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: CRISPR
Alx4
Name: aristaless-like homeobox 4
Synonyms: Aristaless-like 4
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: CRISPR
NCBI: 11695
HGNC: HGNC:450
Homologene: 7229
Genetic Alterations
Alx4f mice possess loxP sites flanking exon 2 of the Alx4 gene. These mice may be useful for generating conditional Alx4 mutants when studying craniofacial and epidermal development.
Genotype Determination
ES Cell Line
Not applicable
Phenotype

Alx4 encodes a homeobox domain transcription factor that is essential for craniofacial, limb, hair and skin development. Mutations in this gene have been associated with frontonasal dysplasia, alopecia as well as skin and male genital abnormalities. These Alx4f mice harbor loxP sites flanking exon 2 of the aristaless-like homeobox 4 (Alx4) gene. Homozygous mice are viable and fertile. When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 2 deleted in the cre-expressing tissues. Deletion of exon 2 results in a frameshift and production of a truncated, non-functional protein lacking both the homeodomain and the OAR domain. These mice may be useful for studying the regulatory role of ALX4 in craniofacial and epidermal development.


Conditional phenotype: When bred to mice that express tissue-specific Cre recombinase, resulting offspring will have exon 2 deleted in the cre-expressing tissues. Deletion of exon 2 results in a frameshift and production of a truncated, non-functional protein lacking both the homeodomain and the OAR domain. These mice may be useful for studying the regulatory role of ALX4 in craniofacial and epidermal development.

Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Developmental Biology
  • Models for Human Disease
  • Research Tools
Donor
Rulang Jiang, Ph.D., Cincinnati Children's Hospital Medical Center (CCHMC), University of Rochester.
Primary Reference
Strain Development
The Alx4f allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. Guide RNAs (AGAGGGGTCTTTAGCAGGTG and TTGCGTGGTGTTTAGCTGAG) were used to target the introns flanking exon 2 of the aristaless-like homeobox 4 (Alx4) gene on chromosome 2. Alx4 transcript Alx4-201 (ENSMUST00000042078.10) was used as reference for the exon number and the guide sequences. The sgRNAs, ssDNA, and cas9 nuclease mRNA were introduced into the cytoplasm of zygotes derived from C57BL/6NCrl mice with well recognized pronuclei. Correctly targeted pups were identified by PCR and sequencing. The resulting Alx4f mice were backcrossed to a C57BL/6 background for at least 3 generations to reduce off-target events. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. An aliquot of frozen sperm was used to fertilize C57BL/6J oocytes to establish a live colony.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
3
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Average litter size
7 to 9
Recommended wean age
4 Weeks
Average Pups Weaned
7 to 9

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Justin Levy .

A Commercial License Agreement from the Submitter is required for for-profit entities to use this strain. For more information, please contact Justin Levy

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
071823-JAX-SPERM Cryo-preserved spermatozoa $459.00 / $459.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
071823-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / $2,123.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.