Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
The wild-type Gt(ROSA)26Sor (Gene ID:14910) locus was displaced with the transgene. Note that the nucleotide sequence of MCV sT is codon-optimized as detailed below. The protein sequence, however, is identical to YP_009111422.1 that is linked to MCPyV_gp4 (Gene ID:10987419)
Codon-optimized MCV small T antigen open reading frame:
5'‑ATGGACTTGGTCCTTAACAGGAAAGAACGAGAGGCCCTGTGTAAGCTCTTGGAGATCGCTCCAAACTGTTACGGGAATATCCCTCTGATGAAGGCGGCATTCAAACGGTCATGTCTCAAACATCACCCAGATAAGGGTGGCAACCCTGTGATTATGATGGAACTGAATACCCTTTGGAGCAAGTTCCAGCAAAACATACACAAACTGAGGAGCGACTTCTCCATGTTTGATGAGGTGTCTACCAAGTTCCCCTGGGAGGAATATGGCACACTCAAAGATTACATGCAGAGTGGCTACAATGCTAGATTCTGCCGCGGACCCGGGTGCATGCTGAAACAACTGAGAGACAGCAAGTGCGCCTGTATCAGTTGTAAGCTTTCCCGGCAGCATTGCTCCCTGAAAACGTTGAAGCAGAAGAATTGCCTCACATGGGGAGAATGCTTTTGTTATCAGTGCTTCATTCTGTGGTTTGGATTTCCGCCCACTTGGGAGTCATTCGACTGGTGGCAGAAAACTCTGGAAGAAACCGACTATTGCTTGCTTCACTTGCATCTCTTCTGA‑3'
Homozygous: Not tested
Hetero/Hemizygous: High-dose of Tamoxifen induces chromosomal instability and lethality while low dose Tamoxifen shows hyperplasia of ear skin.
Cre-excised Phenotype: Undetermined
Colony Surveillance Program and Current Health Reports
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
The donor or their institution limits the distribution to non-profit institutions only.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.