Strain Detail Sheet

Strain Name:
C57BL/6J-Kcnb1em3Kea/Mmucd
Stock Number:
071286-UCD
Citation ID:
RRID:MMRRC_071286-UCD
Other Names:
Kcnb1em3Kea

Strain Information

Gene Details

Kcnb1em3Kea
Name: potassium voltage gated channel, Shab-related subfamily, member 1; endonuclease-mediated mutation 3, Jennifer Kearney
Type: Allele
Species: Mus musculus (mouse)
Chromosome:
Alteration at locus: CRISPR
Kcnb1
Name: potassium voltage gated channel, Shab-related subfamily, member 1
Synonyms: Kv2.1, Shab, Kcr1-1
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: CRISPR
NCBI: 16500
HGNC: HGNC:6231
Homologene: 37988
Genome Browser [Click image to go to Jbrowse]



Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
CRISPR/Cas9 editing was used to introduce two single nucleotide changes, resulting in the R306C missense mutation and a silent change to disrupt the protospacer adjacent motif (PAM,-NGG).
ES Cell Line
Not applicable

Strain Description

Phenotype
Mutation in Kcnb1 does not affect channel expression; it affects voltage sensing. Heterozygous and homozygous R306C mice exhibited pronounced hyperactivity, altered susceptibility to flurothyl and kainic acid induced-seizures, and frequent, long runs of spike wave discharges on EEG.

Useful to study encephalopathies.
Strain Development
CRISPR/Cas9 and homology directed repair with sgRNA (GGGCCAACTTCAGGATGCGC) and repair oligo (5'-CTGCGCAGCGTGAAGCCCAAGGACTGCAGACCGGTGGAGTGGCGGGCCAACTTCAGGATGCaCAGaATGCGCATGATGCGGAAGATCTGGACCACACGGCGCACATTCTGGAACTGCAGC)NCBI Gene ID 16500, NM_008420.4 with variants c. , predicting p.Arg306Cys (R306C).Electroporation into C57BL/6J oocutes (origin: C57BL/6J Jackson Lab #000664)Tail snip PCR to confirm genotype of mosaic founders.Mating of mosaic founders with C57BL/6J (Jackson Lab #000664) for germline transmission.Scnrreing of N1 offspringe to confirm presence of desired knockin mutation, absence local rearrangments, and absence of mutations at predicted off-target sites with

Edited Version:
CRISPR/Cas9 and homology directed repair with sgRNA and repair oligo NCBI Gene ID 16500, NM_008420.4 with variants c. , predicting p.Arg306Cys (R306C).Electroporation into C57BL/6J oocytes. Tail snip PCR to confirm genotype of mosaic founders. Mating of mosaic founders with C57BL/6J for germline transmission. Screening of N1 offspring to confirm presence of desired knock-in mutation, absence local rearrangements, and absence of mutations at predicted off-target sites with
Suggested Control Mice
C57BL/6J

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.

Research Applications

  • Diabetes
  • Metabolism
  • Models for Human Disease
  • Neurobiology

Strain Origin

Donor
Jennifer Kearney, Ph.D., Northwestern University.
Primary Reference

Kang SK, Hawkins NA, Echevarria-Cooper DM, Baker EM, Dixon CJ, Speakes N, Kearney JA. Altered neurological and neurobehavioral phenotypes in a mouse model of the recurrent KCNB1 -p.R306C voltage-sensor variant. bioRxiv [Preprint]. 2023 Mar 30:2023.03.29.534736. doi: 10.1101/2023.03.29.534736. (Medline PMID: 37034689)

Colony and Husbandry Information

Special Considerations

N/A

Health Status Report

Colony Surveillance Program and Current Health Reports

For more information about this colony's health status contact mmrrc@ucdavis.edu

Appearance

Coat Color
Black
Eye
Black

Breeding

MMRRC Breeding System
Backcross
Generation
N12
Overall Breeding Performance
Excellent

Reproductive Statistics

Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 7 to 9 months 7 to 9 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Availability Level

The availability level for this product has not been determined.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Sponsored Research.

Conditions of Distribution

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Sponsored Research

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.
To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.