Strain Detail Sheet

Strain Name:
C57BL/6J-Hnrnph2em1Jpat/Mmjax
Stock Number:
071606-JAX
Citation ID:
RRID:MMRRC_071606-JAX
Other Names:
Hnrnph2 P209L KI

Strain Information

Gene Details

Hnrnph2em1Jpat
Name: heterogeneous nuclear ribonucleoprotein H2; endonuclease-mediated mutation 1, J Paul Taylor
Synonyms: Hnrnph2P209L, Hnrnph2em2Jpat
Type: Allele
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Knock-In
Hnrnph2
Name: heterogeneous nuclear ribonucleoprotein H2
Synonyms: Ftp3, Hnrph2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
Alteration at locus: Knock-In
NCBI: 56258
HGNC: HGNC:5042
Homologene: 23165
Genome Browser [Click image to go to Jbrowse]



Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
Hnrnph2 P209L knock-in mice carry a proline to leucine amino acid substitution at codon 209 (P209L) in the X-linked Hnrnph2 (heterogeneous nuclear ribonucleoprotein H2) gene. Mice exhibit impaired motor function, increased susceptibility to audiogenic seizures and male embryonic lethality. These mice may be useful for research in Bain type of X-linked syndromic intellectual developmental disorder (MRXSB).

Genotype Determination
ES Cell Line
Not applicable

Strain Description

Phenotype
Hnrnph2 P209L KI mice recapitulate clinical features of Bain type of X-linked syndromic intellectual developmental disorder (MRXSB), including impaired motor function and increased susceptibility to audiogenic seizures. Male hemizygous mice have partial embryonic lethality and reduced postnatal survival but are fertile if surviving until sexual maturity. Female heterozygous mice are viable and fertile.

Mutations in the human heterogeneous nuclear ribonucleoprotein H2 (HNRNPH2) gene cause Bain type of X-linked syndromic intellectual developmental disorder (MRXSB, OMIM: 300986) with features that include developmental delay, motor function deficits, and seizures. More than 90% of patients with hnRNPH2 have a missense mutation within or adjacent to the nuclear localization signal (NLS). R206W and R206Q are the two most common missense variants. HNRNPH2 is an RNA binding protein that complexes with heterogenous nuclear RNA (hnRNA). The human and mouse genes are highly conserved differing at only 4 amino acids out of 449 amino acids

Hnrnph2 P209L knockin mice carry CRISPR/cas9-generated, human-equivalent P209L knock-in mutation of the X-linked mouse heterogeneous nuclear ribonucleoprotein H2 (Hnrnph2) gene. This missense mutation modifies the nuclear localization signal (NLS) and impairs the interaction between HNRNPH2 and its nuclear transport receptor KapΒ2. Mice recapitulate clinical features of Bain type of X-linked syndromic intellectual developmental disorder (MRXSB), including impaired motor function and increased susceptibility to audiogenic seizures. Hemizyous males show increased embryonic lethality (~36% mutant vs. ~64% WT survival) and reduced postnatal survival but are fertile if they survive until sexual maturity. Less than 15% of hemizygous male mice lived to 8 weeks of age. Female heterozygous mice are viable and fertile. Homozygous females have reduced viability, fertility has not been determined. Crosses of heterozygous females with hemizygous males produce pups at expected Mendelian ratios. Males, and to a lesser extent females, are smaller than wild type littermates, have craniofacial abnormalities, and increased incidence of hydrocephalus.

Of note, the R206W mutation created by Dr. Taylor is available as C57BL/6J-Hnrnph2em2Jpat/Mmjax (MMRRC Stock No. 071607).
MeSH Terms
  • Animals
  • Humans
  • Male
  • Mice
  • Disease Models, Animal
  • Mutation
  • Mutation, Missense
  • Neurodevelopmental Disorders
  • Seizures/genetics
  • Gain of Function Mutation
  • Neurodevelopmental Disorders/genetics
  • Neurodevelopmental Disorders/therapy
  • Intellectual Disability/genetics
  • Epilepsy/genetics
Strain Development
CRISPR/cas9 methodologies were used to insert an proline to leucine amino acid substitution at codon 209 (P209L; c.842 C > T) in exon 4 of the X-linked mouse Hnrnph2 gene. Hnrnph2 transcript Hnrnph2-201 (ENSMUSG00000045427) was used as reference for the exon number and guide sequences. Single guide RNA (CCCGGCCUAUCAUAGGGACC), cas9 endonuclease and a single stranded oligonucleotide repair template were electroporated into C57BL/6J-derived zygotes. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. PCR and DNA sequencing confirmed the mutation. Resultant mice were backcrossed to C57BL/6J for 17 generations by the donating laboratory. Upon arrival, mice were bred to C57BL/6J for at least one generation to establish the colony.

Suggested Control Mice
Wild type littermates from female heterozygous mutant x male C57BL/6J (RRID:IMSR_JAX:000664) crosses, or C57BL/6J (RRID:IMSR_JAX:000664) mice.

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Research Applications

  • Developmental Biology
  • Models for Human Disease
  • Neurobiology

Strain Origin

Donor
J. Paul Taylor, M.D., St. Jude Children's Research Hospital.
Primary Reference

Korff A, Yang X, O'Donovan K, Gonzalez A, Teubner BJ, Nakamura H, Messing J, Yang F, Carisey AF, Wang YD, Patni T, Sheppard H, Zakharenko SS, Chook YM, Taylor JP, Kim HJ. A murine model of hnRNPH2-related neurodevelopmental disorder reveals a mechanism for genetic compensation by Hnrnph1. J Clin Invest. 2023 Jul 17;133(14):e160309. doi: 10.1172/JCI160309. (Medline PMID: 37463454)

Kelvington BA, Abel T. hnRNPH2 gain-of-function mutations reveal therapeutic strategies and a role for RNA granules in neurodevelopmental disorders. J Clin Invest. 2023 Jul 17;133(14):e171499. doi: 10.1172/JCI171499. (Medline PMID: 37463443)

Colony and Husbandry Information

Special Considerations

N/A

Health Status Report

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.

Appearance

Coat Color
Black
Eye
Black

Breeding

MMRRC Breeding System
Backcross
Generation
N=17
Overall Breeding Performance
Good

Reproductive Statistics

NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Reduced X-linked
Homozygotes are fertile: Undetermined X-linked
Hetero/Hemizygotes are fertile: Yes Reduced
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Variable
Recommended wean age
3 Weeks
Average Pups Weaned
Variable

Order Request Information

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Esther Allay.

Conditions of Distribution

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Esther Allay

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*		 Units Notes
071606-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit		 Aliquot Approximate quantity3
071606-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit		 Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.