Strain Name:
C57BL/6J-MtgxR0575Btlr/Mmmh
Stock Number:
038765-MU
Citation ID:
RRID:MMRRC_038765-MU
Other Names:
R0575 (G1), C57BL/6J-MtgxR0575Btlr
Major Collection:

Strain Information

Aggf1
Name: angiogenic factor with G patch and FHA domains 1
Synonyms: 2310029P06Rik, VG5Q, 2010009L17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66549
Homologene: 41220
Adsl
Name: adenylosuccinate lyase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11564
HGNC: HGNC:291
Homologene: 12
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Pcdh20
Name: protocadherin 20
Synonyms: PCDH13, C630015B17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219257
Homologene: 11277
Ccbe1
Name: collagen and calcium binding EGF domains 1
Synonyms: 9430093N24Rik, 4933426F18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 320924
Homologene: 15852
Gmds
Name: GDP-mannose 4, 6-dehydratase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218138
HGNC: HGNC:4369
Homologene: 75968
Atf7ip2
Name: activating transcription factor 7 interacting protein 2
Synonyms: 4930558K11Rik, PSM2, Get-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75329
Homologene: 23509
Strbp
Name: spermatid perinuclear RNA binding protein
Synonyms: Spnr, 6430510M02Rik, C230082I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20744
Homologene: 7548
Efcab6
Name: EF-hand calcium binding domain 6
Synonyms: 4932408N08Rik, 4931407K02Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77627
Homologene: 11259
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Pcnx4
Name: pecanex homolog 4
Synonyms: 1810048J11Rik, Pcnxl4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117147
Homologene: 24930
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Lgi4
Name: leucine-rich repeat LGI family, member 4
Synonyms: clp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243914
Homologene: 16408
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Or5b107
Name: olfactory receptor family 5 subfamily B member 107
Synonyms: GA_x6K02T2RE5P-3491834-3492772, MOR202-35, Olfr1461
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258299
HGNC: HGNC:8324
Homologene: 128112
Cyp26b1
Name: cytochrome P450, family 26, subfamily b, polypeptide 1
Synonyms: P450RAI-2, retinoic acid B1, CP26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232174
Homologene: 23179
Zfp518a
Name: zinc finger protein 518A
Synonyms: 6330417C12Rik, 2810401C22Rik, Zfp518
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72672
VEGA: 19
Homologene: 19378
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Prob1
Name: proline rich basic protein 1
Synonyms: LOC381148, Gm1614
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381148
Homologene: 83773
Frs3
Name: fibroblast growth factor receptor substrate 3
Synonyms: SNT2, Frs2beta, 4930417B13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 107971
Homologene: 4845
Agbl5
Name: ATP/GTP binding protein-like 5
Synonyms: 9430057O19Rik, Ccp5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231093
Homologene: 11053
Anapc11
Name: anaphase promoting complex subunit 11
Synonyms: 1110011I19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66156
Homologene: 41136
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Ankrd44
Name: ankyrin repeat domain 44
Synonyms: E130014H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329154
Homologene: 27547
Dcun1d1
Name: defective in cullin neddylation 1 domain containing 1
Synonyms: pTes3, Rp42, Tes3, SCCRO, DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 114893
Homologene: 10773
Spa17
Name: sperm autoantigenic protein 17
Synonyms: band 34, Sp17
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20686
VEGA: 9
Homologene: 7951
Or2y1b
Name: olfactory receptor family 2 subfamily Y member 1B
Synonyms: GA_x6K02T2QP88-6117098-6116163, MOR256-55, L45, Olfr10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18307
Homologene: 81347
4931414P19Rik
Name: RIKEN cDNA 4931414P19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74359
VEGA: 14
Homologene: 11078
Dtwd2
Name: DTW domain containing 2
Synonyms: 8030470C17Rik, 1190002H09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68857
Homologene: 79701
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 54,762,310 bp
  • C to A, chromosome 1 at 164,176,244 bp
  • T to A, chromosome 2 at 37,640,873 bp
  • T to C, chromosome 3 at 35,897,785 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • A to T, chromosome 5 at 30,894,454 bp
  • A to G, chromosome 6 at 84,575,306 bp
  • G to A, chromosome 7 at 31,060,093 bp
  • G to A, chromosome 7 at 119,659,201 bp
  • T to C, chromosome 9 at 37,603,393 bp
  • G to A, chromosome 11 at 49,318,053 bp
  • A to G, chromosome 11 at 120,599,366 bp
  • A to G, chromosome 12 at 72,567,236 bp
  • T to G, chromosome 13 at 21,984,168 bp
  • T to G, chromosome 13 at 31,940,583 bp
  • T to A, chromosome 13 at 95,368,397 bp
  • C to T, chromosome 14 at 54,591,252 bp
  • A to G, chromosome 14 at 88,467,612 bp
  • C to T, chromosome 15 at 80,963,685 bp
  • T to G, chromosome 15 at 83,967,700 bp
  • G to T, chromosome 16 at 10,237,211 bp
  • T to A, chromosome 16 at 36,918,809 bp
  • A to G, chromosome 17 at 34,717,206 bp
  • A to G, chromosome 17 at 47,703,723 bp
  • A to G, chromosome 17 at 74,689,237 bp
  • T to C, chromosome 18 at 35,654,721 bp
  • C to A, chromosome 18 at 49,698,472 bp
  • T to A, chromosome 18 at 66,093,995 bp
  • T to A, chromosome 19 at 13,165,387 bp
  • T to A, chromosome 19 at 40,912,315 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0575 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
038765-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.