Strain Name:
C57BL/6J-MtgxR0989Btlr/Mmmh
Stock Number:
039109-MU
Citation ID:
RRID:MMRRC_039109-MU
Other Names:
R0989 (G1), C57BL/6J-MtgxR0989Btlr
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Pnoc
Name: prepronociceptin
Synonyms: N23K, Npnc1, proorphanin, OFQ/N, N/OFQ
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18155
VEGA: 14
HGNC: HGNC:9163
Homologene: 4537
Enpp2
Name: ectonucleotide pyrophosphatase/phosphodiesterase 2
Synonyms: Autotaxin, Npps2, PD-Ialpha, Pdnp2, ATX
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18606
HGNC: HGNC:3357
Homologene: 4526
Nfkb1
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms: NF kappaB1, p50 subunit of NF kappaB, p50/p105, p50, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18033
HGNC: HGNC:7794
Homologene: 2971
Vti1a
Name: vesicle transport through interaction with t-SNAREs 1A
Synonyms: Vti1-rp2, 1110018K19Rik, 1110014F16Rik, 4921537J05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53611
VEGA: 19
Homologene: 39963
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Ipo8
Name: importin 8
Synonyms: OM-1, 6230418K12Rik, Om1, C130009K11Rik, Ranbp8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320727
HGNC: HGNC:9853
Homologene: 48430
Tram1
Name: translocating chain-associating membrane protein 1
Synonyms: TRAMP, 1810049E02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72265
Homologene: 8621
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Sez6l2
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233878
Homologene: 8237
Minar1
Name: membrane integral NOTCH2 associated receptor 1
Synonyms: DD1, AF529169
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209743
Homologene: 17782
Fam120a
Name: family with sequence similarity 120, member A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218236
VEGA: 13
Homologene: 8752
Crim1
Name: cysteine rich transmembrane BMP regulator 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50766
VEGA: 17
HGNC: HGNC:2359
Homologene: 9510
Golm1
Name: golgi membrane protein 1
Synonyms: D030064E01Rik, PSEC0257, GP73, 2310001L02Rik, Golph2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105348
VEGA: 13
Homologene: 12346
Prcp
Name: prolylcarboxypeptidase (angiotensinase C)
Synonyms: 2610104A14Rik, 2510048K03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72461
HGNC: HGNC:9344
Homologene: 55867
Fbxw11
Name: F-box and WD-40 domain protein 11
Synonyms: HOS, BTRCP2, BTRC2, Fbxw1b, 2310065A07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103583
Homologene: 76444
Pcolce2
Name: procollagen C-endopeptidase enhancer 2
Synonyms: Pcpe2, 2400001O18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76477
HGNC: HGNC:8739
Homologene: 8357
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Nr3c2
Name: nuclear receptor subfamily 3, group C, member 2
Synonyms: aldosterone receptor, Mlr, MR, mineralocorticoid receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110784
HGNC: HGNC:7979
Homologene: 121495
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Gabra5
Name: gamma-aminobutyric acid type A receptor subunit alpha 5
Synonyms: A230018I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110886
HGNC: HGNC:4079
Homologene: 20219
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Atp7b
Name: ATPase, Cu++ transporting, beta polypeptide
Synonyms: WND, Wilson protein, Atp7a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11979
HGNC: HGNC:870
Homologene: 20063
Slc4a9
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 9
Synonyms: AE4, D630024F24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240215
VEGA: 18
Homologene: 23732
Parp3
Name: poly (ADP-ribose) polymerase family, member 3
Synonyms: Adprt3, PARP-3, A930002C11Rik, Adprtl3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235587
HGNC: HGNC:273
Homologene: 4005
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1, Pyk1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Tspoap1
Name: TSPO associated protein 1
Synonyms: peripheral, Bzrap1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207777
Homologene: 37961
Zfy2
Name: zinc finger protein 2, Y-linked
Synonyms: Zfy-2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22768
Homologene: 56456
Acadsb
Name: acyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms: 1300003O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66885
HGNC: HGNC:91
Homologene: 1216
Gm4846
Name: predicted gene 4846
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226601
Homologene: 136281
Or13a24
Name: olfactory receptor family 13 subfamily A member 24
Synonyms: GA_x6K02T2PBJ9-42723314-42724246, MOR253-13P, MOR253-12P, MOR253-10P, MOR253-12P, MOR253-13P, Olfr1553-ps1, Olfr1523-ps1, Olfr538
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258201
Homologene: 110491
Neurod2
Name: neurogenic differentiation 2
Synonyms: Ndrf, bHLHa1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18013
HGNC: HGNC:7763
Homologene: 4489
C4bp
Name: complement component 4 binding protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12269
HGNC: HGNC:1325
Ssna1
Name: SS nuclear autoantigen 1
Synonyms: 1190004J23Rik, 1110003H09Rik, NA14, N14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68475
Homologene: 2768
Or52k2
Name: olfactory receptor family 52 subfamily K member 2
Synonyms: GA_x6K02T2PBJ9-5323062-5324015, MOR28-1, Olfr552
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259106
Homologene: 73941
Tspan31
Name: tetraspanin 31
Synonyms: 2700085A14Rik, Tspan31, Sas
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67125
VEGA: 10
Homologene: 4359
Rnaseh1
Name: ribonuclease H1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19819
VEGA: 12
Homologene: 2202
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,827,881 bp
  • T to A, chromosome 1 at 13,566,403 bp
  • T to C, chromosome 1 at 66,646,440 bp
  • G to A, chromosome 1 at 130,643,053 bp
  • G to A, chromosome 1 at 166,487,120 bp
  • T to C, chromosome 2 at 25,271,563 bp
  • T to G, chromosome 2 at 129,126,077 bp
  • A to C, chromosome 3 at 108,403,272 bp
  • A to G, chromosome 3 at 135,589,396 bp
  • TGCGTTGCACCGATACCGGG to TG, chromosome 4 at 134,357,677 bp
  • A to G, chromosome 5 at 124,797,938 bp
  • T to C, chromosome 6 at 148,796,682 bp
  • A to G, chromosome 7 at 57,413,809 bp
  • A to T, chromosome 7 at 92,910,216 bp
  • G to A, chromosome 7 at 102,604,483 bp
  • A to G, chromosome 7 at 126,959,844 bp
  • A to G, chromosome 7 at 131,428,544 bp
  • A to C, chromosome 7 at 140,574,287 bp
  • A to G, chromosome 8 at 22,028,694 bp
  • T to C, chromosome 8 at 77,187,564 bp
  • C to T, chromosome 9 at 67,229,454 bp
  • T to A, chromosome 9 at 89,602,035 bp
  • T to A, chromosome 9 at 95,638,723 bp
  • C to T, chromosome 9 at 106,473,082 bp
  • A to G, chromosome 10 at 60,534,510 bp
  • T to A, chromosome 10 at 127,068,327 bp
  • T to C, chromosome 11 at 32,735,149 bp
  • T to A, chromosome 11 at 87,765,823 bp
  • A to G, chromosome 11 at 98,327,979 bp
  • T to G, chromosome 12 at 28,655,572 bp
  • A to G, chromosome 12 at 85,269,395 bp
  • G to T, chromosome 13 at 48,885,743 bp
  • A to T, chromosome 13 at 59,640,183 bp
  • T to A, chromosome 14 at 50,891,822 bp
  • T to C, chromosome 14 at 65,404,868 bp
  • A to T, chromosome 15 at 54,875,759 bp
  • T to C, chromosome 15 at 86,031,279 bp
  • A to G, chromosome 16 at 32,680,358 bp
  • T to C, chromosome 17 at 78,200,944 bp
  • T to A, chromosome 18 at 36,536,867 bp
  • C to T, chromosome 19 at 55,499,229 bp
  • T to A, chromosome Y at 2,109,879 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R0989 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039109-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.