Strain Name:
C57BL/6J-MtgxR1023Btlr/Mmmh
Stock Number:
039125-MU
Citation ID:
RRID:MMRRC_039125-MU
Other Names:
R1023 (G1), C57BL/6J-MtgxR1023Btlr
Major Collection:

Strain Information

Tert
Name: telomerase reverse transcriptase
Synonyms: TR
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21752
VEGA: 13
Homologene: 31141
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: 9330151F09Rik, Trap150, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Gnpat
Name: glyceronephosphate O-acyltransferase
Synonyms: D1Ertd819e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14712
HGNC: HGNC:4416
Homologene: 40716
Ap3d1
Name: adaptor-related protein complex 3, delta 1 subunit
Synonyms: mBLVR1, Bolvr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11776
VEGA: 10
HGNC: HGNC:568
Homologene: 2926
Ubtf
Name: upstream binding transcription factor, RNA polymerase I
Synonyms: UBF1, Tcfubf, UBF, A930005G04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21429
Homologene: 7970
Taf1b
Name: TATA-box binding protein associated factor, RNA polymerase I, B
Synonyms: mTAFI68, 4930408G01Rik, A230108M10Rik, p63
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21340
VEGA: 12
Homologene: 31331
Mib2
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: 2210008I11Rik, Zzank1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76580
Homologene: 16062
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Yy1
Name: YY1 transcription factor
Synonyms: UCRBP transcription factor, delta transcription factor, NF-E1, Yin Yang 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22632
Homologene: 2556
Lap3
Name: leucine aminopeptidase 3
Synonyms: Pep-S, Pep-7, LAP, peptidase S, Pep7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66988
Homologene: 41072
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, 2810425C21Rik, D13Ucla1, DAP-Kinase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Dync2i1
Name: dynein 2 intermediate chain 1
Synonyms: D430033N04Rik, Wdr60, Dync2l1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217935
VEGA: 12
Homologene: 23067
Htr5a
Name: 5-hydroxytryptamine (serotonin) receptor 5A
Synonyms: Htr5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15563
HGNC: HGNC:5300
Homologene: 22461
Enam
Name: enamelin
Synonyms: abte
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13801
HGNC: HGNC:3344
Homologene: 9698
Cdkl2
Name: cyclin dependent kinase like 2
Synonyms: Kkm, KKIAMRE, 5330436L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53886
HGNC: HGNC:1782
Homologene: 55793
Mef2b
Name: myocyte enhancer factor 2B
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17259
Homologene: 48381
Col9a2
Name: collagen, type IX, alpha 2
Synonyms: Col9a-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12840
HGNC: HGNC:2218
Homologene: 37535
Plac8
Name: placenta-specific 8
Synonyms: onzin, C15, D5Wsu111e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231507
Homologene: 32328
1110002E22Rik
Name: RIKEN cDNA 1110002E22 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102634333
Homologene: 131709
Pold2
Name: polymerase (DNA directed), delta 2, regulatory subunit
Synonyms: p50, po1D2, 50kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18972
HGNC: HGNC:9176
Homologene: 4538
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Ptprt
Name: protein tyrosine phosphatase receptor type T
Synonyms: RPTPrho
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Mamdc2
Name: MAM domain containing 2
Synonyms: 1200015L10Rik, mamcan
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71738
VEGA: 19
Homologene: 17722
Usp20
Name: ubiquitin specific peptidase 20
Synonyms: 1700055M05Rik, Vdu2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74270
Homologene: 4861
Or5h19
Name: olfactory receptor family 5 subfamily H member 19
Synonyms: GA_x54KRFPKG5P-55265713-55264787, MOR183-8, Olfr187
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258319
Homologene: 133069
Cdh15
Name: cadherin 15
Synonyms: Cdh14, Mcad, M cadherin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Pnpt1
Name: polyribonucleotide nucleotidyltransferase 1
Synonyms: PNPase, polynucleotide phosphorylase, 1200003F12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71701
Homologene: 12404
Or11h4b
Name: olfactory receptor family 11 subfamily H member 4B
Synonyms: GA_x6K02T2PMLR-6420220-6419279, MOR106-7, MOR106-16, Olfr747
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258264
Homologene: 10652
Scart1
Name: scavenger receptor family member expressed on T cells 1
Synonyms: E430002D04Rik, Cd163l1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244233
Homologene: 129778
Dqx1
Name: DEAQ RNA-dependent ATPase
Synonyms: 2310066E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93838
Homologene: 14143
Spata2
Name: spermatogenesis associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 263876
Homologene: 4407
4930562F07Rik
Name: RIKEN cDNA 4930562F07 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75255
Meltf
Name: melanotransferrin
Synonyms: MTf, CD228, melanotransferrin, Mfi2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30060
VEGA: 16
HGNC: HGNC:7037
Homologene: 4335
Cryge
Name: crystallin, gamma E
Synonyms: Cryg-6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12968
HGNC: HGNC:2411
Homologene: 128417
Slc1a7
Name: solute carrier family 1 (glutamate transporter), member 7
Synonyms: EAAT5, A930031E15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242607
Homologene: 21327
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 65,050,786 bp
  • A to G, chromosome 1 at 160,077,487 bp
  • G to T, chromosome 2 at 31,007,813 bp
  • A to G, chromosome 2 at 161,558,943 bp
  • G to A, chromosome 2 at 164,892,585 bp
  • A to G, chromosome 2 at 167,485,222 bp
  • C to T, chromosome 3 at 138,066,871 bp
  • G to A, chromosome 4 at 108,007,573 bp
  • A to C, chromosome 4 at 113,238,103 bp
  • G to A, chromosome 4 at 121,044,010 bp
  • G to A, chromosome 4 at 126,180,089 bp
  • C to T, chromosome 4 at 155,659,460 bp
  • A to T, chromosome 5 at 27,842,998 bp
  • C to T, chromosome 5 at 45,495,211 bp
  • A to G, chromosome 5 at 88,501,967 bp
  • A to T, chromosome 5 at 92,039,286 bp
  • A to T, chromosome 5 at 100,556,581 bp
  • T to A, chromosome 6 at 35,234,706 bp
  • G to A, chromosome 6 at 83,061,089 bp
  • T to A, chromosome 7 at 140,224,463 bp
  • C to T, chromosome 8 at 70,165,597 bp
  • T to C, chromosome 8 at 122,865,200 bp
  • A to T, chromosome 8 at 124,870,780 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • A to G, chromosome 10 at 39,832,639 bp
  • A to T, chromosome 10 at 80,714,258 bp
  • A to G, chromosome 10 at 128,121,807 bp
  • G to T, chromosome 11 at 5,875,140 bp
  • T to C, chromosome 11 at 29,141,328 bp
  • T to C, chromosome 11 at 102,311,450 bp
  • G to T, chromosome 12 at 24,509,559 bp
  • T to A, chromosome 12 at 108,793,531 bp
  • T to C, chromosome 12 at 116,232,657 bp
  • T to C, chromosome 13 at 60,730,985 bp
  • A to G, chromosome 13 at 73,642,059 bp
  • A to G, chromosome 13 at 102,735,496 bp
  • A to T, chromosome 14 at 50,681,016 bp
  • T to A, chromosome 16 at 31,884,960 bp
  • A to T, chromosome 16 at 59,035,815 bp
  • A to T, chromosome 19 at 23,310,907 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1023 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039125-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.