Strain Name:
C57BL/6J-MtgxR1148Btlr/Mmmh
Stock Number:
039221-MU
Citation ID:
RRID:MMRRC_039221-MU
Other Names:
R1148 (G1), C57BL/6J-MtgxR1148Btlr
Major Collection:

Strain Information

Alg10b
Name: ALG10 alpha-1,2-glucosyltransferase
Synonyms: Deaf1, LOC380959, nse5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380959
VEGA: 15
Homologene: 6030
Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Vldlr
Name: very low density lipoprotein receptor
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22359
Homologene: 443
Slc25a12
Name: solute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms: B230107K20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78830
Homologene: 48235
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Dars1
Name: aspartyl-tRNA synthetase 1
Synonyms: 5730439G15Rik, Dars
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226414
HGNC: HGNC:2678
Homologene: 1032
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Osbpl11
Name: oxysterol binding protein-like 11
Synonyms: ORP-11
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106326
Homologene: 23385
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66887
Homologene: 12050
Dpp8
Name: dipeptidylpeptidase 8
Synonyms: 4932434F09Rik, 2310004I03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74388
VEGA: 9
Homologene: 57098
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C130057E09Rik, C030046E11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226089
Homologene: 13806
Sez6l2
Name: seizure related 6 homolog like 2
Synonyms: Psk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233878
Homologene: 8237
Bbs9
Name: Bardet-Biedl syndrome 9
Synonyms: EST 3159894, E130103I17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319845
Homologene: 44480
2810021J22Rik
Name: RIKEN cDNA 2810021J22 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69944
Homologene: 138400
Ablim2
Name: actin-binding LIM protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231148
Homologene: 82366
Cyp4x1
Name: cytochrome P450, family 4, subfamily x, polypeptide 1
Synonyms: Cyp4a28-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 81906
Homologene: 75853
Morc2a
Name: microrchidia 2A
Synonyms: 8430403M08Rik, Zcwcc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74522
Homologene: 8966
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase, TEP, PTPMEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Cilp
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214425
HGNC: HGNC:1980
Homologene: 2679
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1537Clo, b2b1565Clo, b2b1154Clo, b2b1134Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Arsi
Name: arylsulfatase i
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 545260
Homologene: 44428
Mapk15
Name: mitogen-activated protein kinase 15
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 332110
Homologene: 16371
Cfap58
Name: cilia and flagella associated protein 58
Synonyms: LOC381229, Ccdc147
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381229
VEGA: 19
Homologene: 77312
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Fgd5
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: ZFYVE23, C330025N11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232237
Homologene: 27798
Ttc22
Name: tetratricopeptide repeat domain 22
Synonyms: 4732467L16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230576
Homologene: 89253
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Folh1
Name: folate hydrolase 1
Synonyms: mopsm, prostate-specific membrane antigen, glutamate carboxypeptidase II, GCP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53320
Homologene: 55826
Mapk12
Name: mitogen-activated protein kinase 12
Synonyms: Sapk3, Erk6, P38gamma, Prkm12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29857
VEGA: 15
HGNC: HGNC:6874
Homologene: 55705
Disp2
Name: dispatched RND transporter family member 2
Synonyms: DispB, B230210L08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214240
Homologene: 24916
Wsb2
Name: WD repeat and SOCS box-containing 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59043
Homologene: 32417
Hexd
Name: hexosaminidase D
Synonyms: Hexdc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 238023
Homologene: 68120
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: WHISTLE, Whsc1l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
AC149051.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Arhgef16
Name: Rho guanine nucleotide exchange factor 16
Synonyms: Neuroblastoma
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230972
Homologene: 82484
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Trp53rka
Name: transformation related protein 53 regulating kinase A
Synonyms: 2810408M09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381406
Homologene: 6042
Coq8a
Name: coenzyme Q8A
Synonyms: 4632432J16Rik, Cabc1, Adck3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67426
Homologene: 11345
Or5g9
Name: olfactory receptor family 5 subfamily G member 9
Synonyms: GA_x6K02T2Q125-47195323-47196267, MOR175-3, Olfr1009
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258565
Homologene: 17297
Ly6h
Name: lymphocyte antigen 6 family member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 23934
HGNC: HGNC:6728
Homologene: 1758
Esp4
Name: exocrine gland secreted peptide 4
Synonyms: Gm20580
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100126777
VEGA: 17
Homologene: 136356
Rbm4b
Name: RNA binding motif protein 4B
Synonyms: 4921506I22Rik, Lark2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66704
Homologene: 57033
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 119,675,709 bp
  • T to C, chromosome 1 at 119,684,540 bp
  • T to C, chromosome 1 at 128,366,909 bp
  • G to A, chromosome 1 at 180,169,403 bp
  • G to A, chromosome 2 at 71,312,568 bp
  • C to A, chromosome 2 at 85,722,276 bp
  • G to A, chromosome 2 at 118,806,418 bp
  • A to G, chromosome 2 at 121,372,077 bp
  • C to A, chromosome 2 at 165,493,041 bp
  • A to G, chromosome 3 at 86,107,327 bp
  • G to A, chromosome 4 at 106,623,031 bp
  • A to G, chromosome 4 at 115,126,555 bp
  • T to C, chromosome 4 at 154,280,889 bp
  • T to C, chromosome 5 at 35,809,261 bp
  • T to C, chromosome 5 at 117,370,677 bp
  • A to G, chromosome 6 at 91,987,631 bp
  • A to G, chromosome 6 at 119,952,006 bp
  • T to C, chromosome 7 at 86,761,730 bp
  • C to A, chromosome 7 at 126,961,812 bp
  • A to G, chromosome 8 at 25,713,380 bp
  • A to G, chromosome 8 at 63,926,855 bp
  • A to G, chromosome 8 at 86,636,540 bp
  • T to C, chromosome 9 at 15,996,774 bp
  • T to C, chromosome 9 at 22,575,100 bp
  • T to C, chromosome 9 at 65,053,832 bp
  • T to A, chromosome 9 at 65,280,316 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • T to C, chromosome 10 at 11,213,482 bp
  • C to T, chromosome 10 at 69,882,539 bp
  • T to C, chromosome 10 at 74,170,560 bp
  • TCGC to TC, chromosome 11 at 3,146,254 bp
  • CCTCTC to CCTCTCTC, chromosome 11 at 3,177,419 bp
  • A to G, chromosome 11 at 3,678,557 bp
  • T to C, chromosome 11 at 58,876,718 bp
  • A to G, chromosome 11 at 121,221,267 bp
  • T to C, chromosome 12 at 103,112,667 bp
  • T to C, chromosome 15 at 28,421,690 bp
  • G to T, chromosome 15 at 75,565,172 bp
  • A to G, chromosome 15 at 75,998,155 bp
  • T to C, chromosome 15 at 89,134,623 bp
  • T to C, chromosome 15 at 90,227,865 bp
  • T to C, chromosome 16 at 33,227,212 bp
  • A to C, chromosome 17 at 40,602,371 bp
  • G to A, chromosome 18 at 60,916,651 bp
  • A to G, chromosome 19 at 4,757,499 bp
  • A to G, chromosome 19 at 27,241,291 bp
  • T to C, chromosome 19 at 29,579,849 bp
  • C to T, chromosome 19 at 47,988,504 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1148 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039221-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.