Strain Name:
C57BL/6J-MtgxR1177Btlr/Mmmh
Stock Number:
039249-MU
Citation ID:
RRID:MMRRC_039249-MU
Other Names:
R1177 (G1), C57BL/6J-MtgxR1177Btlr
Major Collection:

Strain Information

Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Chgb
Name: chromogranin B
Synonyms: secretogranin I, Scg-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12653
HGNC: HGNC:1930
Homologene: 1375
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Mthfd1l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: 2410004L15Rik, Fthfsdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270685
Homologene: 56706
Nop58
Name: NOP58 ribonucleoprotein
Synonyms: SIK similar protein, MSSP, Nol5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 55989
Homologene: 7024
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Tlr2
Name: toll-like receptor 2
Synonyms: Ly105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24088
Homologene: 20695
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Nrbp1
Name: nuclear receptor binding protein 1
Synonyms: B230344L17Rik, Nrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192292
HGNC: HGNC:7993
Homologene: 8373
Lrrc8c
Name: leucine rich repeat containing 8 family, member C
Synonyms: E430036I04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100604
Homologene: 12997
Trpc6
Name: transient receptor potential cation channel, subfamily C, member 6
Synonyms: mtrp6, Trrp6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22068
VEGA: 9
Homologene: 37944
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Bbs7
Name: Bardet-Biedl syndrome 7
Synonyms: 8430406N16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71492
Homologene: 12395
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Naip1
Name: NLR family, apoptosis inhibitory protein 1
Synonyms: D13Lsd1, Naip, Birc1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17940
VEGA: 13
HGNC: HGNC:7634
Homologene: 113589
Dpp6
Name: dipeptidylpeptidase 6
Synonyms: Dpp-6, Peplb, In(5)6H-p, Rw, LOC384168, B930011P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13483
HGNC: HGNC:3010
Homologene: 22560
Or2b4
Name: olfactory receptor family 2 subfamily B member 4
Synonyms: GA_x6K02T2PSCP-2264806-2265753, MOR256-3, A3, Olfr124, SR1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 259064
Homologene: 74266
Myo5b
Name: myosin VB
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17919
HGNC: HGNC:7603
Homologene: 49481
Or4c105
Name: olfactory receptor family 4 subfamily C member 105
Synonyms: GA_x6K02T2Q125-50290367-50291296, MOR232-7, Olfr1202
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258454
Homologene: 133021
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Ppp4r4
Name: protein phosphatase 4, regulatory subunit 4
Synonyms: 8430415E04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74521
Homologene: 12571
Cox15
Name: cytochrome c oxidase assembly protein 15
Synonyms: 2900026G05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226139
HGNC: HGNC:2263
Homologene: 5848
Map3k21
Name: mitogen-activated protein kinase kinase kinase 21
Synonyms: BC021891
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234878
Homologene: 32778
Sv2c
Name: synaptic vesicle glycoprotein 2c
Synonyms: 4930527L09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75209
Homologene: 57152
Bivm
Name: basic, immunoglobulin-like variable motif containing
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 246229
Homologene: 9783
Akr1c19
Name: aldo-keto reductase family 1, member C19
Synonyms: 1810010N06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432720
HGNC: HGNC:387
Homologene: 134145
Zfp94
Name: zinc finger protein 94
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22756
Homologene: 86846
Spag1
Name: sperm associated antigen 1
Synonyms: TPR-containing protein involved in spermatogenesis, tpis
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26942
VEGA: 15
Homologene: 8081
Cers4
Name: ceramide synthase 4
Synonyms: Trh1, 2900019C14Rik, CerS4, Lass4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67260
Homologene: 11582
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Spc25
Name: SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms: 2610205L13Rik, 2600017H08Rik, Spbc25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66442
Homologene: 41387
Slc5a6
Name: solute carrier family 5 (sodium-dependent vitamin transporter), member 6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330064
Homologene: 23277
Fkrp
Name: fukutin related protein
Synonyms: LGMD1I, MDC1C, A830029B19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243853
Homologene: 11513
AC122767.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Or10d4
Name: olfactory receptor family 10 subfamily D member 4
Synonyms: GA_x6K02T2PVTD-33365879-33366814, MOR224-7P, MOR224-13, Olfr963
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258087
VEGA: 9
Homologene: 105216
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 44,142,963 bp
  • T to A, chromosome 1 at 59,700,932 bp
  • G to A, chromosome 1 at 107,523,214 bp
  • A to T, chromosome 2 at 69,197,241 bp
  • A to G, chromosome 2 at 88,817,360 bp
  • T to C, chromosome 2 at 101,642,278 bp
  • T to C, chromosome 2 at 119,926,446 bp
  • A to G, chromosome 2 at 132,793,470 bp
  • ACCTCCTCCTCCTCCTCCTCC to ACCTCCTCCTCCTCCTCC, chromosome 3 at 5,400,831 bp
  • A to T, chromosome 3 at 36,610,180 bp
  • A to G, chromosome 3 at 83,838,734 bp
  • A to G, chromosome 3 at 90,202,003 bp
  • A to G, chromosome 5 at 27,663,473 bp
  • A to G, chromosome 5 at 31,039,302 bp
  • T to A, chromosome 5 at 31,245,813 bp
  • T to C, chromosome 5 at 105,606,836 bp
  • T to C, chromosome 7 at 16,810,527 bp
  • T to C, chromosome 7 at 24,303,528 bp
  • A to T, chromosome 7 at 128,596,127 bp
  • A to G, chromosome 8 at 4,516,931 bp
  • A to G, chromosome 8 at 70,780,324 bp
  • A to T, chromosome 8 at 125,944,838 bp
  • G to A, chromosome 9 at 8,658,304 bp
  • A to T, chromosome 9 at 21,348,583 bp
  • A to G, chromosome 9 at 39,669,641 bp
  • T to C, chromosome 9 at 108,962,441 bp
  • A to C, chromosome 10 at 3,985,661 bp
  • T to C, chromosome 11 at 3,229,902 bp
  • C to T, chromosome 11 at 36,063,177 bp
  • A to G, chromosome 11 at 71,107,721 bp
  • G to A, chromosome 12 at 103,576,323 bp
  • A to G, chromosome 13 at 4,242,669 bp
  • G to T, chromosome 13 at 95,989,763 bp
  • C to T, chromosome 13 at 100,427,064 bp
  • A to T, chromosome 15 at 36,234,767 bp
  • A to G, chromosome 17 at 25,846,054 bp
  • A to T, chromosome 17 at 37,805,952 bp
  • A to G, chromosome 17 at 75,225,285 bp
  • G to A, chromosome 18 at 74,644,072 bp
  • A to G, chromosome 19 at 43,740,002 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1177 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039249-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.