Strain Name:
C57BL/6J-MtgxR1179Btlr/Mmmh
Stock Number:
039251-MU
Citation ID:
RRID:MMRRC_039251-MU
Other Names:
R1179 (G1), C57BL/6J-MtgxR1179Btlr
Major Collection:

Strain Information

Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Rad54l
Name: RAD54 like (S. cerevisiae)
Synonyms: RAD54
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19366
HGNC: HGNC:9826
Homologene: 48227
Kcnj1
Name: potassium inwardly-rectifying channel, subfamily J, member 1
Synonyms: ROMK-2, ROMK, Kir1.1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56379
VEGA: 9
HGNC: HGNC:6255
Homologene: 56764
Vmp1
Name: vacuole membrane protein 1
Synonyms: 4930579A11Rik, 3110098I04Rik, Tmem49, Tango5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75909
Homologene: 23686
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Mc5r
Name: melanocortin 5 receptor
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17203
VEGA: 18
HGNC: HGNC:6933
Homologene: 4321
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Ralgps2
Name: Ral GEF with PH domain and SH3 binding motif 2
Synonyms: 1810020P17Rik, 9130014M22Rik, 4921528G01Rik, 2210408F11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78255
Homologene: 23421
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Nrip3
Name: nuclear receptor interacting protein 3
Synonyms: ICRFP703N2430Q5.2, D7H11orf14, ICRFP703B1614Q5.2, A330103B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78593
HGNC: HGNC:1167
Homologene: 10764
Ift81
Name: intraflagellar transport 81
Synonyms: CDV-1R, Cdv1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12589
Homologene: 7664
Pnisr
Name: PNN interacting serine/arginine-rich
Synonyms: 5730406M06Rik, Sfrs18
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66625
Homologene: 32802
Golga2
Name: golgin A2
Synonyms: GM130
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99412
HGNC: HGNC:4425
Homologene: 3300
Nrbp1
Name: nuclear receptor binding protein 1
Synonyms: B230344L17Rik, Nrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192292
HGNC: HGNC:7993
Homologene: 8373
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Ltbp1
Name: latent transforming growth factor beta binding protein 1
Synonyms: LTBP-1, 9430031G15Rik, b2b1000Clo, Ltbp1L
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268977
HGNC: HGNC:6714
Homologene: 522
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Gls2
Name: glutaminase 2 (liver, mitochondrial)
Synonyms: Lga, A330074B06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216456
Homologene: 40861
Aknad1
Name: AKNA domain containing 1
Synonyms: 4921525H12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329738
Homologene: 51892
Or6c202
Name: olfactory receptor family 6 subfamily C member 202
Synonyms: GA_x6K02T2PULF-10846420-10845467, MOR114-8, Olfr771
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258540
Homologene: 74047
Hrnr
Name: hornerin
Synonyms: 1110033K19Rik, A530063N20Rik, S100a18
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68723
Homologene: 138092
Naga
Name: N-acetyl galactosaminidase, alpha
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17939
VEGA: 15
HGNC: HGNC:7631
Homologene: 221
Or8g55
Name: olfactory receptor family 8 subfamily G member 55
Synonyms: GA_x6K02T2PVTD-33572803-33573747, MOR171-17, Olfr972
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258603
VEGA: 9
Homologene: 121532
Zfp773
Name: zinc finger protein 773
Synonyms: 2810409K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76373
Homologene: 137393
Bnipl
Name: BCL2/adenovirus E1B 19kD interacting protein like
Synonyms: BNIPL-2, BNIPL-1, BNIPL2, BNIPL1, PP753, BNIPL, 1700128A13Rik, BNIP-S
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171388
Homologene: 15900
Ears2
Name: glutamyl-tRNA synthetase 2, mitochondrial
Synonyms: 3230401I01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67417
Homologene: 6907
Pacsin3
Name: protein kinase C and casein kinase substrate in neurons 3
Synonyms: 4921507A02Rik, 6330413E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80708
HGNC: HGNC:8572
Homologene: 41117
Tmem17
Name: transmembrane protein 17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103765
Homologene: 17795
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 156,901,799 bp
  • G to T, chromosome 2 at 32,303,695 bp
  • A to G, chromosome 2 at 91,263,860 bp
  • T to C, chromosome 3 at 93,332,543 bp
  • G to T, chromosome 3 at 95,242,836 bp
  • T to C, chromosome 3 at 108,752,467 bp
  • A to G, chromosome 4 at 21,865,937 bp
  • A to T, chromosome 4 at 116,111,320 bp
  • T to A, chromosome 5 at 31,245,813 bp
  • T to C, chromosome 5 at 122,602,710 bp
  • G to A, chromosome 5 at 144,777,939 bp
  • AGCTGCTGCTGCTGCTGCTGCTGCTGC to AGCTGCTGCTGCTGCTGCTGCTGC, chromosome 7 at 7,133,093 bp
  • A to G, chromosome 7 at 109,763,555 bp
  • C to T, chromosome 7 at 122,055,757 bp
  • T to A, chromosome 8 at 87,688,072 bp
  • T to A, chromosome 9 at 32,396,766 bp
  • T to C, chromosome 9 at 39,874,075 bp
  • A to G, chromosome 10 at 86,950,301 bp
  • A to T, chromosome 10 at 128,199,234 bp
  • A to C, chromosome 10 at 129,160,058 bp
  • T to A, chromosome 11 at 7,167,054 bp
  • A to T, chromosome 11 at 22,518,454 bp
  • C to T, chromosome 11 at 36,063,177 bp
  • T to C, chromosome 11 at 86,607,229 bp
  • A to T, chromosome 11 at 119,281,128 bp
  • T to A, chromosome 13 at 100,219,830 bp
  • A to G, chromosome 13 at 100,219,838 bp
  • T to A, chromosome 15 at 82,330,156 bp
  • A to G, chromosome 17 at 75,225,285 bp
  • C to G, chromosome 18 at 68,338,670 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1179 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039251-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.