Strain Name:
C57BL/6J-MtgxR1240Btlr/Mmmh
Stock Number:
039307-MU
Citation ID:
RRID:MMRRC_039307-MU
Other Names:
R1240 (G1), C57BL/6J-MtgxR1240Btlr
Major Collection:

Strain Information

Mc1r
Name: melanocortin 1 receptor
Synonyms: e, Mshra, extension recessive yellow, Mcr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17199
HGNC: HGNC:6929
Homologene: 1789
H2-DMa
Name: histocompatibility 2, class II, locus DMa
Synonyms: H2-Ma, H-2Ma, H2-M alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14998
HGNC: HGNC:4934
Homologene: 4464
Lgi1
Name: leucine-rich repeat LGI family, member 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56839
HGNC: HGNC:6572
Homologene: 3737
Kat2b
Name: K(lysine) acetyltransferase 2B
Synonyms: A930006P13Rik, Pcaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18519
HGNC: HGNC:8638
Homologene: 20834
Cenpc1
Name: centromere protein C1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12617
HGNC: HGNC:1854
Homologene: 1371
Plxna1
Name: plexin A1
Synonyms: NOV, Plxn1, 2600013D04Rik, PlexA1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18844
HGNC: HGNC:9099
Homologene: 56426
Dph6
Name: diphthamine biosynthesis 6
Synonyms: 5730421E18Rik, Diphthine ammonia ligase, Atpbd4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66632
Homologene: 80244
Gab1
Name: growth factor receptor bound protein 2-associated protein 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14388
HGNC: HGNC:4066
Homologene: 1542
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Fh1
Name: fumarate hydratase 1
Synonyms: fumarase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14194
HGNC: HGNC:3700
Homologene: 115
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Prdm15
Name: PR domain containing 15
Synonyms: Zfp298, E130018M06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114604
Homologene: 56941
Ift74
Name: intraflagellar transport 74
Synonyms: 1700029H06Rik, Cmg1, Ccdc2, b2b796Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67694
Homologene: 11831
Slc49a4
Name: solute carrier family 49 member 4
Synonyms: RCC4, Dirc2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224132
Homologene: 13137
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: 0710008O11Rik, BRMS1, D12Ertd407e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Bach2
Name: BTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms: E030004N02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12014
Homologene: 7240
Chst2
Name: carbohydrate sulfotransferase 2
Synonyms: Gn6st, N-acetylglucosamine-6-O-sulfotransferase, GST-2, C130041E03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54371
HGNC: HGNC:1970
Homologene: 3150
Nbeal2
Name: neurobeachin-like 2
Synonyms: 1110014F23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235627
Homologene: 86422
Casp2
Name: caspase 2
Synonyms: Ich-1, Caspase-2, Nedd2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12366
HGNC: HGNC:1503
Homologene: 7254
Hp1bp3
Name: heterochromatin protein 1, binding protein 3
Synonyms: Hp1bp74
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15441
Homologene: 7774
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Synrg
Name: synergin, gamma
Synonyms: L71-5, Ap1gbp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217030
HGNC: HGNC:557
Homologene: 105680
Arpc3
Name: actin related protein 2/3 complex, subunit 3
Synonyms: Arp2/3 complex subunit p21-Arc, p21-Ar, 1110006A04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
NCBI: 56378
HGNC: HGNC:706
Homologene: 4178
Dbr1
Name: debranching RNA lariats 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83703
Homologene: 9428
Pja2
Name: praja ring finger ubiquitin ligase 2
Synonyms: Neurodap1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224938
Homologene: 32233
Cdh6
Name: cadherin 6
Synonyms: K-cadherin, cad6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12563
VEGA: 15
HGNC: HGNC:1765
Homologene: 21027
Chst9
Name: carbohydrate sulfotransferase 9
Synonyms: GalNAc4ST-2, 5430438D01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71367
Homologene: 12861
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Snx13
Name: sorting nexin 13
Synonyms: RGS-PX1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217463
VEGA: 12
Homologene: 41011
Grk2
Name: G protein-coupled receptor kinase 2
Synonyms: beta ARK, beta ARK1, beta-AR kinase-1, beta-adrenergic receptor kinase-1, Bark-1, Adrbk-1, betaARK1, Adrbk1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110355
HGNC: HGNC:289
Homologene: 1223
Ccdc73
Name: coiled-coil domain containing 73
Synonyms: 2210415I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211936
Homologene: 52235
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: EG640524, Spnb5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640524
Homologene: 41150
Nlrp1a
Name: NLR family, pyrin domain containing 1A
Synonyms: Nalp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195046
Homologene: 133820
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Trmt11
Name: tRNA methyltransferase 11
Synonyms: 3110045I18Rik, 2410075D05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73681
VEGA: 10
Homologene: 6876
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545874
Homologene: 135915
Otoa
Name: otoancorin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246190
Homologene: 71803
4932411E22Rik
Name: RIKEN cDNA 4932411E22 gene
Type: Gene
Species: Mouse
Chromosome: 11
Fam227b
Name: family with sequence similarity 227, member B
Synonyms: 4930525F21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75823
Homologene: 27384
Myo15b
Name: myosin XVB
Synonyms: LOC217328, LOC380737, E330039G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217328
Aoc1
Name: amine oxidase, copper-containing 1
Synonyms: 1600012D06Rik, Abp1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76507
HGNC: HGNC:80
Homologene: 68159
Slc7a13
Name: solute carrier family 7, (cationic amino acid transporter, y+ system) member 13
Synonyms: AGT1, XAT2, AGT-1, 0610009O04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74087
Homologene: 23656
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: 4930415K13Rik, Rgsl2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240816
Homologene: 129962
Nr1d2
Name: nuclear receptor subfamily 1, group D, member 2
Synonyms: Rev-erb beta, RVR
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 353187
HGNC: HGNC:7963
Homologene: 3763
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: 4732473B16Rik, Fam46b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100342
Homologene: 24928
Slc22a22
Name: solute carrier family 22 (organic cation transporter), member 22
Synonyms: OAT-PG, BC026439
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210463
Homologene: 18166
Pctp
Name: phosphatidylcholine transfer protein
Synonyms: PC-TP, StarD2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18559
HGNC: HGNC:8752
Homologene: 32054
Inf2
Name: inverted formin, FH2 and WH2 domain containing
Synonyms: EG629699, 2610204M08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70435
VEGA: 12
Homologene: 82406
Or8u8
Name: olfactory receptor family 8 subfamily U member 8
Synonyms: IE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963, Olfr52
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18352
Homologene: 105200
Cyp3a44
Name: cytochrome P450, family 3, subfamily a, polypeptide 44
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 337924
HGNC: HGNC:2638
Homologene: 133568
Klhl30
Name: kelch-like 30
Synonyms: 4631423F02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70788
Homologene: 18891
Asgr2
Name: asialoglycoprotein receptor 2
Synonyms: Asgr-2, Asgr, ASGPR2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11890
HGNC: HGNC:743
Homologene: 912
Pm20d2
Name: peptidase M20 domain containing 2
Synonyms: LOC242377, Acy1l2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242377
Homologene: 19025
Sepsecs
Name: Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
Synonyms: SLA, D5Ertd135e, SecS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211006
Homologene: 15031
Or4b1d
Name: olfactory receptor family 4 subfamily B member 1D
Synonyms: MTPCR05, MOR227-7P, GA_x6K02T2Q125-51573576-51572650, MOR227-9_p, Olfr32
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18331
HGNC: HGNC:8290
Homologene: 110550
Gkn1
Name: gastrokine 1
Synonyms: BRICD1, 2200002K21Rik, AMP-18
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66283
Homologene: 10487
Lsmem1
Name: leucine-rich single-pass membrane protein 1
Synonyms: LOC380755, Gm889
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380755
VEGA: 12
Homologene: 18800
Top1mt
Name: DNA topoisomerase 1, mitochondrial
Synonyms: 2900052H09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72960
Homologene: 43082
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 66,635,902 bp
  • T to C, chromosome 1 at 91,361,015 bp
  • A to G, chromosome 1 at 153,785,191 bp
  • A to T, chromosome 1 at 175,604,015 bp
  • T to A, chromosome 2 at 52,296,309 bp
  • T to G, chromosome 2 at 86,182,109 bp
  • T to G, chromosome 2 at 90,138,813 bp
  • A to T, chromosome 2 at 104,991,561 bp
  • T to C, chromosome 2 at 114,644,718 bp
  • A to G, chromosome 2 at 120,059,555 bp
  • T to A, chromosome 2 at 126,124,585 bp
  • A to T, chromosome 4 at 19,819,212 bp
  • T to C, chromosome 4 at 32,563,198 bp
  • C to T, chromosome 4 at 33,174,859 bp
  • A to G, chromosome 4 at 94,692,937 bp
  • A to T, chromosome 4 at 113,717,107 bp
  • T to C, chromosome 4 at 133,486,504 bp
  • T to C, chromosome 4 at 138,229,698 bp
  • T to A, chromosome 4 at 139,476,128 bp
  • T to C, chromosome 5 at 52,660,679 bp
  • G to T, chromosome 5 at 86,035,510 bp
  • T to C, chromosome 5 at 122,404,179 bp
  • T to G, chromosome 5 at 124,089,921 bp
  • T to G, chromosome 5 at 145,774,440 bp
  • T to A, chromosome 6 at 42,268,945 bp
  • T to C, chromosome 6 at 48,905,615 bp
  • T to A, chromosome 6 at 87,349,116 bp
  • C to T, chromosome 6 at 89,321,050 bp
  • T to A, chromosome 6 at 123,851,905 bp
  • C to A, chromosome 6 at 125,603,308 bp
  • A to G, chromosome 7 at 28,120,525 bp
  • T to C, chromosome 7 at 121,156,490 bp
  • A to G, chromosome 8 at 48,287,893 bp
  • A to C, chromosome 8 at 80,788,530 bp
  • T to A, chromosome 8 at 123,408,260 bp
  • T to C, chromosome 9 at 95,405,483 bp
  • G to T, chromosome 9 at 99,584,020 bp
  • A to G, chromosome 9 at 110,627,108 bp
  • A to C, chromosome 10 at 27,041,124 bp
  • T to C, chromosome 10 at 30,590,825 bp
  • G to T, chromosome 11 at 70,096,850 bp
  • A to G, chromosome 11 at 71,113,466 bp
  • A to T, chromosome 11 at 84,023,356 bp
  • A to G, chromosome 11 at 89,392,134 bp
  • T to C, chromosome 11 at 90,002,814 bp
  • C to A, chromosome 11 at 115,880,501 bp
  • G to T, chromosome 12 at 35,091,406 bp
  • GTACATACATACATACATACATACATACA to GTACATACATACATACATACATACATACATACA, chromosome 12 at 40,185,261 bp
  • C to A, chromosome 12 at 55,844,508 bp
  • G to A, chromosome 12 at 112,610,776 bp
  • C to T, chromosome 13 at 97,929,492 bp
  • A to T, chromosome 14 at 18,211,891 bp
  • T to A, chromosome 15 at 13,057,455 bp
  • G to A, chromosome 15 at 57,250,872 bp
  • T to A, chromosome 15 at 66,828,548 bp
  • T to C, chromosome 15 at 75,670,067 bp
  • T to C, chromosome 16 at 14,146,762 bp
  • A to G, chromosome 16 at 35,698,009 bp
  • C to T, chromosome 16 at 97,837,600 bp
  • G to T, chromosome 17 at 34,138,406 bp
  • A to G, chromosome 17 at 53,624,397 bp
  • G to T, chromosome 17 at 64,309,618 bp
  • C to T, chromosome 18 at 15,453,174 bp
  • A to G, chromosome 19 at 4,290,679 bp
  • A to G, chromosome 19 at 38,284,051 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1240 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039307-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.