Strain Name:
C57BL/6J-MtgxR1247Btlr/Mmmh
Stock Number:
039314-MU
Citation ID:
RRID:MMRRC_039314-MU
Other Names:
R1247 (G1), C57BL/6J-MtgxR1247Btlr
Major Collection:

Strain Information

Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: AS3, Aprin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100710
Homologene: 41001
Huwe1
Name: HECT, UBA and WWE domain containing 1
Synonyms: Ib772, 5430439H10Rik, LOC382250, Ureb1, C430014N20Rik, Mule, Arf-bp1
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 59026
Homologene: 45994
Tbr1
Name: T-box brain transcription factor 1
Synonyms: T-box brain gene 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21375
Homologene: 4807
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Samd4
Name: sterile alpha motif domain containing 4
Synonyms: 4933436G17Rik, 1700111L17Rik, 1700024G08Rik, Smaug, sunk
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74480
Homologene: 19167
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270066
Homologene: 49075
4930527J03Rik
Name: RIKEN cDNA 4930527J03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 75164
Cyp3a44
Name: cytochrome P450, family 3, subfamily a, polypeptide 44
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 337924
HGNC: HGNC:2638
Homologene: 133568
Sox15
Name: SRY (sex determining region Y)-box 15
Synonyms: Sox16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20670
Homologene: 74586
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • ACCC to ACC, chromosome 1 at 178,276,503 bp
  • C to T, chromosome 2 at 61,811,618 bp
  • A to G, chromosome 5 at 145,791,667 bp
  • C to A, chromosome 5 at 150,541,274 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 5 at 150,775,354 bp
  • G to C, chromosome 7 at 132,995,189 bp
  • T to C, chromosome 8 at 72,492,571 bp
  • T to C, chromosome 11 at 69,656,494 bp
  • G to A, chromosome 12 at 75,967,490 bp
  • AGG to AG, chromosome 14 at 47,064,328 bp
  • G to GAAA, chromosome 14 at 47,087,758 bp
  • G to C, chromosome X at 151,901,570 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1247 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039314-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.