Strain Name:
C57BL/6J-MtgxR1375Btlr/Mmmh
Stock Number:
039439-MU
Citation ID:
RRID:MMRRC_039439-MU
Other Names:
R1375 (G1), C57BL/6J-MtgxR1375Btlr
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Olr1
Name: oxidized low density lipoprotein (lectin-like) receptor 1
Synonyms: LOX-1, Scare1, SR-EI
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108078
HGNC: HGNC:8133
Homologene: 1910
Pipox
Name: pipecolic acid oxidase
Synonyms: Pso
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19193
Homologene: 40640
Rbpms2
Name: RNA binding protein with multiple splicing 2
Synonyms: 2400008B06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71973
VEGA: 9
Homologene: 49895
Stk17b
Name: serine/threonine kinase 17b (apoptosis-inducing)
Synonyms: Drak2, 3110009A03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98267
Homologene: 31231
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Il17b
Name: interleukin 17B
Synonyms: Zcyto7, 1110006O16Rik, 1700006N07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56069
VEGA: 18
HGNC: HGNC:5982
Homologene: 8689
Ccng1
Name: cyclin G1
Synonyms: cyclin G
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12450
HGNC: HGNC:1592
Homologene: 2995
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Rpp30
Name: ribonuclease P/MRP 30 subunit
Synonyms: TSG15, Rnasep2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54364
VEGA: 19
Homologene: 38180
Inpp5f
Name: inositol polyphosphate-5-phosphatase F
Synonyms: cI-27, SAC2, 5830435P03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101490
Homologene: 8962
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Or6b6
Name: olfactory receptor family 6 subfamily B member 6
Synonyms: GA_x6K02T2PBJ9-9352783-9351839, MOR103-4, Olfr711
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259037
Homologene: 128111
Heg1
Name: heart development protein with EGF-like domains 1
Synonyms: LOC268884, 5530401I02Rik, 9530025L16Rik, 4632417D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77446
Homologene: 35276
Or8b46
Name: olfactory receptor family 8 subfamily B member 46
Synonyms: GA_x6K02T2PVTD-32239063-32239995, MOR165-3, Olfr910
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258807
VEGA: 9
Homologene: 115510
Cep85l
Name: centrosomal protein 85-like
Synonyms: Gm9766
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100038725
VEGA: 10
Homologene: 52598
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432486
Homologene: 32576
Ggn
Name: gametogenetin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243897
Homologene: 45139
Or6c211
Name: olfactory receptor family 6 subfamily C member 211
Synonyms: GA_x6K02T2PULF-11349138-11348182, MOR110-10, Olfr801
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258282
Homologene: 138306
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210417
Homologene: 18180
Abcc3
Name: ATP-binding cassette, sub-family C member 3
Synonyms: 1700019L09Rik, MRP3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Gm17541
Name: predicted gene, 17541
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 12
NCBI: 100416664
VEGA: 12
Dapk2
Name: death-associated protein kinase 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13143
HGNC: HGNC:2675
Homologene: 74940
Mdfic2
Name: MyoD family inhibitor domain containing 2
Synonyms: LOC330390, Gm765
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330390
Homologene: 66631
Septin1
Name: septin 1
Synonyms: PNUTL3, Diff6, Sept1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54204
HGNC: HGNC:2879
Homologene: 23009
Or5w1b
Name: olfactory receptor family 5 subfamily W member 1B
Synonyms: GA_x6K02T2Q125-49151278-49150337, MOR176-2, Olfr1133
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258348
Defb15
Name: defensin beta 15
Synonyms: Defb11, mBD-11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 246082
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,765,947 bp
  • A to T, chromosome 1 at 130,159,686 bp
  • T to A, chromosome 2 at 87,645,737 bp
  • T to C, chromosome 6 at 35,200,071 bp
  • C to T, chromosome 6 at 98,238,299 bp
  • T to C, chromosome 6 at 129,507,076 bp
  • T to C, chromosome 7 at 29,171,941 bp
  • A to G, chromosome 7 at 106,972,098 bp
  • T to C, chromosome 7 at 127,218,161 bp
  • T to A, chromosome 7 at 128,664,029 bp
  • C to A, chromosome 8 at 16,463,081 bp
  • T to C, chromosome 8 at 21,930,055 bp
  • G to A, chromosome 8 at 110,506,222 bp
  • T to A, chromosome 9 at 38,539,534 bp
  • ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC, chromosome 9 at 65,651,666 bp
  • C to G, chromosome 9 at 66,220,643 bp
  • A to T, chromosome 10 at 53,349,258 bp
  • T to A, chromosome 10 at 88,432,573 bp
  • A to T, chromosome 10 at 129,670,372 bp
  • G to A, chromosome 11 at 40,752,114 bp
  • A to G, chromosome 11 at 77,050,717 bp
  • C to A, chromosome 11 at 77,881,210 bp
  • A to G, chromosome 11 at 94,352,216 bp
  • A to T, chromosome 12 at 4,689,825 bp
  • A to G, chromosome 13 at 3,576,029 bp
  • A to T, chromosome 15 at 77,769,368 bp
  • C to A, chromosome 16 at 33,726,876 bp
  • T to C, chromosome 16 at 33,727,309 bp
  • G to A, chromosome 17 at 30,737,295 bp
  • T to C, chromosome 18 at 61,690,254 bp
  • T to C, chromosome 19 at 36,101,273 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R1375 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
039439-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.