Strain Name:
C57BL/6J-MtgxR2328Btlr/Mmmh
Stock Number:
040319-MU
Citation ID:
RRID:MMRRC_040319-MU
Other Names:
R2328 (G1), C57BL/6J-MtgxR2328Btlr
Major Collection:

Strain Information

Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Inpp5a
Name: inositol polyphosphate-5-phosphatase A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212111
HGNC: HGNC:6076
Homologene: 4045
Slamf6
Name: SLAM family member 6
Synonyms: SF2000, NTB-A, KAL1b, KAL1, Ly108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 30925
Homologene: 49945
Dbh
Name: dopamine beta hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13166
HGNC: HGNC:2689
Homologene: 615
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Snapc3
Name: small nuclear RNA activating complex, polypeptide 3
Synonyms: 5031401C21Rik, 4930558A07Rik, 1810020H02Rik, E030018J20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77634
Homologene: 31130
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Trip11
Name: thyroid hormone receptor interactor 11
Synonyms: 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230, GMAP-210
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109181
Homologene: 20897
Akap1
Name: A kinase anchor protein 1
Synonyms: S-AKAP84, AKAP84, AKAP121, DAKAP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11640
HGNC: HGNC:367
Homologene: 31165
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: Erbb-3, Erbb3r, HER3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Dag1
Name: dystroglycan 1
Synonyms: dystrophin associated glycoprotein 1, DG, D9Wsu13e, alpha-dystroglycan, beta-dystroglycan
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13138
HGNC: HGNC:2666
Homologene: 3234
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Ddhd2
Name: DDHD domain containing 2
Synonyms: SAMWD1, 2010305K11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72108
Homologene: 66646
Stard3nl
Name: STARD3 N-terminal like
Synonyms: 0610035N01Rik, 6530409L22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76205
Homologene: 11501
Wtap
Name: WT1 associating protein
Synonyms: 9430038B09Rik, 2810408K05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 60532
Homologene: 68422
Trp53inp1
Name: transformation related protein 53 inducible nuclear protein 1
Synonyms: 2700057G22Rik, SIP, Teap, SIP27, SIP18, Stinp, Tp53inp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 60599
Homologene: 11065
Cggbp1
Name: CGG triplet repeat binding protein 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 106143
HGNC: HGNC:1888
Homologene: 2718
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: A230102O09Rik, Plekhm1l, 9430067K14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Chn1
Name: chimerin 1
Synonyms: 1700112L09Rik, 0710001E19Rik, ARHGAP2, 2900046J01Rik, 0610007I19Rik, alpha2 chimaerin, alpha1 chimaerin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108699
HGNC: HGNC:1943
Homologene: 31056
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Tas2r123
Name: taste receptor, type 2, member 123
Synonyms: T2R23, Tas2r23, STC 9-2, mGR23, mt2r55
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353167
Homologene: 45450
AC145553.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Cyp26a1
Name: cytochrome P450, family 26, subfamily a, polypeptide 1
Synonyms: P450RAI, P450RA, retinoic acid hydrolase, RAH, Cyp26
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13082
VEGA: 19
HGNC: HGNC:2603
Homologene: 37349
Spg21
Name: SPG21, maspardin
Synonyms: BM-019, GL010, ACP33, D9Wsu18e
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 27965
VEGA: 9
Homologene: 9603
Gpc5
Name: glypican 5
Synonyms: A230034F01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 103978
HGNC: HGNC:4453
Homologene: 3285
Zc3h6
Name: zinc finger CCCH type containing 6
Synonyms: 4631426G04Rik, 4833425H18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78751
Homologene: 35328
Aadacl3
Name: arylacetamide deacetylase like 3
Synonyms: LOC230883
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230883
Homologene: 28426
Hace1
Name: HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms: A730034A22Rik, 1700042J16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209462
Homologene: 10807
Or10d5j
Name: olfactory receptor family 10 subfamily D member 5J
Synonyms: GA_x6K02T2PVTD-33657378-33656440, MOR224-10, Olfr976
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258364
VEGA: 9
Homologene: 64863
Ydjc
Name: YdjC homolog (bacterial)
Synonyms: 4930521M19Rik, 1810015A11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69101
Homologene: 19062
Foxd1
Name: forkhead box D1
Synonyms: BF-2, Hfh10, FREAC4, Hfhbf2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15229
HGNC: HGNC:3802
Homologene: 3290
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 64,937,781 bp
  • G to A, chromosome 1 at 171,934,251 bp
  • C to A, chromosome 2 at 13,404,080 bp
  • T to C, chromosome 2 at 27,165,730 bp
  • TGTGG to T, chromosome 2 at 29,154,060 bp
  • GTGGCT to GT, chromosome 2 at 29,154,061 bp
  • G to A, chromosome 2 at 73,631,740 bp
  • A to G, chromosome 2 at 128,993,202 bp
  • T to C, chromosome 4 at 11,164,495 bp
  • T to A, chromosome 4 at 83,435,277 bp
  • C to T, chromosome 4 at 137,511,380 bp
  • T to A, chromosome 4 at 144,455,932 bp
  • T to C, chromosome 6 at 128,510,390 bp
  • A to T, chromosome 6 at 132,847,316 bp
  • T to A, chromosome 7 at 33,288,486 bp
  • T to A, chromosome 7 at 55,894,991 bp
  • T to C, chromosome 7 at 135,710,918 bp
  • A to T, chromosome 7 at 139,478,094 bp
  • T to C, chromosome 8 at 25,727,627 bp
  • A to T, chromosome 8 at 122,899,821 bp
  • A to G, chromosome 9 at 39,956,900 bp
  • T to C, chromosome 9 at 65,486,873 bp
  • T to C, chromosome 9 at 108,209,252 bp
  • G to T, chromosome 10 at 45,648,945 bp
  • C to T, chromosome 10 at 128,583,693 bp
  • A to G, chromosome 11 at 88,845,044 bp
  • T to C, chromosome 11 at 110,276,521 bp
  • T to G, chromosome 12 at 101,878,827 bp
  • A to G, chromosome 12 at 117,886,686 bp
  • T to C, chromosome 13 at 19,359,055 bp
  • T to C, chromosome 13 at 98,355,152 bp
  • C to T, chromosome 14 at 115,788,179 bp
  • A to G, chromosome 16 at 17,147,122 bp
  • A to G, chromosome 16 at 64,856,003 bp
  • C to T, chromosome 17 at 12,967,538 bp
  • A to T, chromosome 17 at 30,794,744 bp
  • T to C, chromosome 19 at 37,699,136 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2328 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040319-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.