Strain Name:
C57BL/6J-MtgxR2895Btlr/Mmmh
Stock Number:
040483-MU
Citation ID:
RRID:MMRRC_040483-MU
Other Names:
R2895 (G1), C57BL/6J-MtgxR2895Btlr
Major Collection:

Strain Information

Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Clasp1
Name: CLIP associating protein 1
Synonyms: CLASP1, 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, B130045P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Cmklr2
Name: chemerin chemokine-like receptor 2
Synonyms: Gpr1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241070
HGNC: HGNC:4463
Homologene: 21094
Sec24d
Name: SEC24 homolog D, COPII coat complex component
Synonyms: 2310020L09Rik, LOC383951
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69608
Homologene: 40986
Leo1
Name: Leo1, Paf1/RNA polymerase II complex component
Synonyms: LOC235497
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235497
VEGA: 9
Homologene: 133895
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Lpar6
Name: lysophosphatidic acid receptor 6
Synonyms: 2610302I02Rik, P2y5, P2ry5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67168
Homologene: 55925
Snx32
Name: sorting nexin 32
Synonyms: Snx6b, B930037P14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225861
VEGA: 19
Homologene: 62637
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Cyb5r4
Name: cytochrome b5 reductase 4
Synonyms: B5+B5R, b5/b5r, 2810034J18Rik, Ncb5or
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 266690
Homologene: 69207
Ttll4
Name: tubulin tyrosine ligase-like family, member 4
Synonyms: 4632407P03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67534
Homologene: 8764
Abhd3
Name: abhydrolase domain containing 3
Synonyms: LABH3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106861
Homologene: 14055
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
H3f3a
Name: H3.3 histone A
Synonyms: H3.3A, H3-3a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15078
Homologene: 134170
Nolc1
Name: nucleolar and coiled-body phosphoprotein 1
Synonyms: P130, NOPP140, 3230402K17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70769
VEGA: 19
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216742
Homologene: 28173
Tlr3
Name: toll-like receptor 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142980
Homologene: 20696
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Plcz1
Name: phospholipase C, zeta 1
Synonyms: 1700041H07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114875
Homologene: 23815
Lonp1
Name: lon peptidase 1, mitochondrial
Synonyms: LON, 1200017E13Rik, Prss15
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74142
VEGA: 17
HGNC: HGNC:9479
Homologene: 3521
Slc7a1
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 1
Synonyms: Rev-1, Rec-1, Atrc-1, Atrc1, 4831426K01Rik, mCAT-1, Cat1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11987
Homologene: 20658
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Rnasel
Name: ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms: 2-5A-dependent RNAase, E230029I04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 24014
Homologene: 8040
Caskin1
Name: CASK interacting protein 1
Synonyms: C630036E02Rik, 3300002N10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268932
VEGA: 17
Homologene: 25873
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Asic1
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Col15a1
Name: collagen, type XV, alpha 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12819
HGNC: HGNC:2192
Homologene: 1396
Cd96
Name: CD96 antigen
Synonyms: Tactile, 1700109I12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 84544
Homologene: 68489
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22625
Homologene: 19318
Atp6v0a1
Name: ATPase, H+ transporting, lysosomal V0 subunit A1
Synonyms: V-ATPase a1, Vpp1, Vpp-1, Atp6n1, Atp6n1a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11975
HGNC: HGNC:865
Homologene: 3795
Sntg2
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268534
Homologene: 41298
Rgsl1
Name: regulator of G-protein signaling like 1
Synonyms: 4930415K13Rik, Rgsl2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240816
Homologene: 129962
Ptpre
Name: protein tyrosine phosphatase receptor type E
Synonyms: PTPe, PTPepsilon, RPTPepsilon
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19267
HGNC: HGNC:9669
Homologene: 31387
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Neu1
Name: neuraminidase 1
Synonyms: sialidase 1, lysosomal sialidase, G9, Bat-7, Neu-1, Map-2, Apl, Aglp, Bat7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18010
HGNC: HGNC:7758
Homologene: 375
Cyp3a11
Name: cytochrome P450, family 3, subfamily a, polypeptide 11
Synonyms: IIIAm1, Cyp3a, Pcn
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13112
HGNC: HGNC:2638
Homologene: 133568
Cep250
Name: centrosomal protein 250
Synonyms: Inmp, B230210E21Rik, Cep2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Stfa3
Name: stefin A3
Synonyms: Stf3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20863
VEGA: 16
HGNC: HGNC:2481
Homologene: 115602
Or11h23
Name: olfactory receptor family 11 subfamily G member 23
Synonyms: GA_x6K02T2PMLR-6454789-6455712, MOR106-9P, Olfr748
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258113
Homologene: 134081
Apol7e
Name: apolipoprotein L 7e
Synonyms: ENSMUSG00000071716
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666348
VEGA: 15
HGNC: HGNC:619
Homologene: 40940
Abhd14b
Name: abhydrolase domain containing 14b
Synonyms: 1810013B01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76491
Homologene: 9125
Akirin1
Name: akirin 1
Synonyms: 6330407G11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68050
Homologene: 11348
Mrps7
Name: mitchondrial ribosomal protein S7
Synonyms: MRP-S7, Rpms7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50529
Homologene: 9321
Crygs
Name: crystallin, gamma S
Synonyms: Opj
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12970
VEGA: 16
HGNC: HGNC:2417
Homologene: 40695
Ppp4r3c1
Name: protein phosphatase 4 regulatory subunit 3C1
Synonyms: 4930415L06Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 245511
Homologene: 133109
Pcdh19
Name: protocadherin 19
Synonyms: LOC279653, B530002L05Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 279653
Homologene: 18916
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 46,139,741 bp
  • T to A, chromosome 1 at 63,183,162 bp
  • T to A, chromosome 1 at 74,685,358 bp
  • T to G, chromosome 1 at 118,459,838 bp
  • T to C, chromosome 1 at 127,822,098 bp
  • T to C, chromosome 1 at 153,760,776 bp
  • T to A, chromosome 1 at 153,827,548 bp
  • C to T, chromosome 1 at 180,803,138 bp
  • C to A, chromosome 2 at 155,992,122 bp
  • T to C, chromosome 3 at 5,244,309 bp
  • T to A, chromosome 3 at 123,343,151 bp
  • T to C, chromosome 4 at 47,312,091 bp
  • T to C, chromosome 4 at 123,738,071 bp
  • A to G, chromosome 5 at 145,869,112 bp
  • A to G, chromosome 5 at 148,340,592 bp
  • G to A, chromosome 6 at 84,186,509 bp
  • A to G, chromosome 6 at 140,023,151 bp
  • A to G, chromosome 7 at 118,189,143 bp
  • G to A, chromosome 7 at 135,643,858 bp
  • A to G, chromosome 7 at 141,791,140 bp
  • T to C, chromosome 8 at 45,397,592 bp
  • T to C, chromosome 9 at 75,461,002 bp
  • C to T, chromosome 9 at 87,040,399 bp
  • C to T, chromosome 9 at 106,450,114 bp
  • A to T, chromosome 9 at 119,661,401 bp
  • T to C, chromosome 11 at 54,475,780 bp
  • A to T, chromosome 11 at 66,076,478 bp
  • A to G, chromosome 11 at 101,044,598 bp
  • G to A, chromosome 11 at 105,348,431 bp
  • A to G, chromosome 11 at 110,202,426 bp
  • A to G, chromosome 11 at 115,605,039 bp
  • A to T, chromosome 12 at 30,226,846 bp
  • A to G, chromosome 13 at 117,874,091 bp
  • T to C, chromosome 14 at 50,710,516 bp
  • A to G, chromosome 14 at 73,239,276 bp
  • A to T, chromosome 15 at 77,714,467 bp
  • T to A, chromosome 15 at 91,814,651 bp
  • G to A, chromosome 15 at 98,843,939 bp
  • A to G, chromosome 15 at 99,696,602 bp
  • C to T, chromosome 16 at 22,805,551 bp
  • C to A, chromosome 16 at 36,452,160 bp
  • G to T, chromosome 16 at 46,117,805 bp
  • A to G, chromosome 17 at 24,489,042 bp
  • A to G, chromosome 17 at 34,932,782 bp
  • A to T, chromosome 17 at 55,687,939 bp
  • A to G, chromosome 17 at 56,615,562 bp
  • A to T, chromosome 18 at 10,658,765 bp
  • G to A, chromosome 19 at 5,498,171 bp
  • CCAGCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGCAGCAGCAGC, chromosome 19 at 46,081,352 bp
  • A to G, chromosome X at 89,932,399 bp
  • CTGTCTCCTCCA to C, chromosome X at 133,681,308 bp
  • TGTCTCCTCCACGTC to TGTC, chromosome X at 133,681,309 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2895 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040483-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.