Strain Name:
C57BL/6J-MtgxR2914Btlr/Mmmh
Stock Number:
040501-MU
Citation ID:
RRID:MMRRC_040501-MU
Other Names:
R2914 (G1), C57BL/6J-MtgxR2914Btlr
Major Collection:

Strain Information

Grm1
Name: glutamate receptor, metabotropic 1
Synonyms: mGluR1, Grm1, Gprc1a, nmf373, rcw, 4930455H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14816
HGNC: HGNC:4593
Homologene: 649
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Yes1
Name: YES proto-oncogene 1, Src family tyrosine kinase
Synonyms: Yes
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22612
Homologene: 55900
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: 2410081F06Rik, 3010002K18Rik, Qprs, Eprs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Slx4ip
Name: SLX4 interacting protein
Synonyms: 2410004I22Rik, 2210009G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74243
Homologene: 49913
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21453
Homologene: 68049
Otud7b
Name: OTU domain containing 7B
Synonyms: 4930463P07Rik, 2900060B22Rik, Za20d1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229603
Homologene: 10624
Pip4k2b
Name: phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Synonyms: c11, PI5P4Kbeta, Pip5k2b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108083
HGNC: HGNC:8998
Homologene: 2634
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Lrrtm1
Name: leucine rich repeat transmembrane neuronal 1
Synonyms: 4632401D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74342
Homologene: 41763
Adgrf3
Name: adhesion G protein-coupled receptor F3
Synonyms: LOC381628, PGR23, Gpr113
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381628
Homologene: 17826
Nktr
Name: natural killer tumor recognition sequence
Synonyms: D9Wsu172e, 5330401F18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18087
HGNC: HGNC:7833
Homologene: 122148
Rab22a
Name: RAB22A, member RAS oncogene family
Synonyms: E130120E14Rik, 3732413A17Rik, Rab22
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19334
HGNC: HGNC:9764
Homologene: 10782
Gak
Name: cyclin G associated kinase
Synonyms: D130045N16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231580
HGNC: HGNC:4113
Homologene: 3846
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Fa2h
Name: fatty acid 2-hydroxylase
Synonyms: G630055L08Rik, Faxdc1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 338521
Homologene: 56284
Cpne8
Name: copine VIII
Synonyms: 1200003E11Rik, 1500031E20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66871
Homologene: 12049
Dclre1b
Name: DNA cross-link repair 1B
Synonyms: mSNM1B, Apollo, SNMIB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140917
Homologene: 32553
Dbn1
Name: drebrin 1
Synonyms: drebrin E2, drebrin A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56320
HGNC: HGNC:2695
Homologene: 3236
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Mapk4
Name: mitogen-activated protein kinase 4
Synonyms: Erk3-related, p63Mapk, A330097D03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225724
HGNC: HGNC:6878
Homologene: 2058
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Snx19
Name: sorting nexin 19
Synonyms: 3526401K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102607
VEGA: 9
Homologene: 8846
Il27ra
Name: interleukin 27 receptor, alpha
Synonyms: WSX-1, IL-27R, Tccr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50931
Homologene: 3562
Mael
Name: maelstrom spermatogenic transposon silencer
Synonyms: 4933405K18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98558
Homologene: 13143
Defb12
Name: defensin beta 12
Synonyms: 9230103N16Rik, mBD-12
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77674
Homologene: 17531
Txk
Name: TXK tyrosine kinase
Synonyms: Rlk, Btkl, PTK4, A130089B16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22165
Homologene: 2497
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: MDK4, Nsk1, Nsk2, Nsk3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Cryl1
Name: crystallin, lambda 1
Synonyms: 1110025H08Rik, A230106J09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68631
VEGA: 14
Homologene: 9322
Mrpl9
Name: mitochondrial ribosomal protein L9
Synonyms: C330013D18Rik, 8030480E20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78523
Homologene: 12696
Cyp4v3
Name: cytochrome P450, family 4, subfamily v, polypeptide 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102294
Homologene: 133054
Fdxacb1
Name: ferredoxin-fold anticodon binding domain containing 1
Synonyms: D630004A14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382137
Homologene: 19813
Vmn1r65
Name: vomeronasal 1 receptor 65
Synonyms: V3R6, V1rd6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81013
Homologene: 110799
Tmod1
Name: tropomodulin 1
Synonyms: E-Tmod, erythrocyte tropomodulin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21916
Homologene: 20701
Mutyh
Name: mutY DNA glycosylase
Synonyms: 5730495A01Rik, Myh, Mutyhbeta, Mutyhalpha, Mutyhc, Mutyhb, Mutyha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70603
HGNC: HGNC:7527
Homologene: 8156
Pigb
Name: phosphatidylinositol glycan anchor biosynthesis, class B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55981
HGNC: HGNC:8959
Homologene: 3570
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,805,630 bp
  • A to T, chromosome 1 at 126,026,537 bp
  • A to T, chromosome 1 at 166,226,610 bp
  • G to A, chromosome 1 at 185,379,742 bp
  • A to T, chromosome 2 at 76,769,635 bp
  • A to G, chromosome 2 at 137,067,591 bp
  • A to G, chromosome 2 at 173,695,281 bp
  • C to A, chromosome 3 at 94,443,801 bp
  • C to A, chromosome 3 at 96,155,955 bp
  • T to C, chromosome 3 at 103,808,114 bp
  • A to T, chromosome 4 at 46,092,259 bp
  • C to A, chromosome 4 at 58,366,938 bp
  • T to A, chromosome 4 at 75,947,101 bp
  • G to A, chromosome 4 at 116,815,629 bp
  • T to A, chromosome 4 at 123,475,911 bp
  • A to G, chromosome 5 at 30,196,994 bp
  • T to C, chromosome 5 at 32,640,582 bp
  • T to C, chromosome 5 at 72,724,451 bp
  • G to A, chromosome 5 at 96,733,915 bp
  • G to A, chromosome 5 at 108,617,065 bp
  • A to T, chromosome 6 at 77,244,979 bp
  • T to A, chromosome 7 at 6,009,041 bp
  • T to C, chromosome 8 at 19,114,814 bp
  • A to G, chromosome 8 at 45,317,656 bp
  • T to A, chromosome 8 at 84,031,613 bp
  • T to C, chromosome 8 at 111,393,649 bp
  • G to A, chromosome 9 at 30,433,532 bp
  • C to T, chromosome 9 at 50,768,399 bp
  • A to T, chromosome 9 at 73,039,778 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • T to C, chromosome 9 at 121,749,604 bp
  • A to G, chromosome 10 at 11,079,857 bp
  • A to G, chromosome 10 at 88,754,475 bp
  • G to T, chromosome 11 at 97,722,434 bp
  • A to G, chromosome 13 at 55,482,421 bp
  • T to C, chromosome 14 at 57,275,918 bp
  • G to T, chromosome 15 at 6,769,995 bp
  • A to T, chromosome 15 at 90,615,099 bp
  • C to T, chromosome 16 at 11,447,453 bp
  • T to C, chromosome 16 at 78,962,190 bp
  • T to C, chromosome 18 at 60,816,084 bp
  • C to T, chromosome 18 at 73,935,165 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R2914 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040501-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.