Strain Name:
C57BL/6J-MtgxR3084Btlr/Mmmh
Stock Number:
040573-MU
Citation ID:
RRID:MMRRC_040573-MU
Other Names:
R3084 (G1), C57BL/6J-MtgxR3084Btlr
Major Collection:

Strain Information

Tnrc6b
Name: trinucleotide repeat containing 6b
Synonyms: A730065C02Rik, D230019K20Rik, 2700090M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213988
VEGA: 15
Homologene: 66194
Pomt1
Name: protein-O-mannosyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99011
HGNC: HGNC:9202
Homologene: 68548
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Washc2
Name: WASH complex subunit 2
Synonyms: C530005J20Rik, D6Wsu116e, Fam21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28006
Homologene: 41686
Dhx9
Name: DExH-box helicase 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13211
HGNC: HGNC:2750
Homologene: 1039
Ppp2r5e
Name: protein phosphatase 2, regulatory subunit B', epsilon
Synonyms: protein phosphatase 2A subunit beta, 4633401M22Rik, B56beta
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26932
VEGA: 12
HGNC: HGNC:9313
Homologene: 55962
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Creb3l1
Name: cAMP responsive element binding protein 3-like 1
Synonyms: BBF-2 (drosophila) homolog, Oasis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26427
Homologene: 8058
Adgra3
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70693
Homologene: 19235
Cenpe
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Sec31a
Name: SEC31 homolog A, COPII coat complex component
Synonyms: 1810024J13Rik, Sec31l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69162
Homologene: 42056
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Ranbp10
Name: RAN binding protein 10
Synonyms: 4432417N03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74334
Homologene: 49639
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: 9930021J17Rik, Fam160a1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Krt34
Name: keratin 34
Synonyms: 4733401E01Rik, Krt1-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16672
HGNC: HGNC:6452
Homologene: 31083
Mmd
Name: monocyte to macrophage differentiation-associated
Synonyms: 1200017E07Rik, 1810073C06Rik, Paqr11
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67468
HGNC: HGNC:7153
Homologene: 8204
Vmn2r85
Name: vomeronasal 2, receptor 85
Synonyms: EG623734
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 623734
Homologene: 129606
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b288Clo, b2b1702Clo, m687Ddg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Or4k36
Name: olfactory receptor family 4 subfamily K member 36
Synonyms: GA_x6K02T2Q125-72366920-72367837, MOR248-1, Olfr1280
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258910
Homologene: 121540
Rsph4a
Name: radial spoke head 4 homolog A (Chlamydomonas)
Synonyms: Rshl3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212892
Homologene: 71779
Vmn1r178
Name: vomeronasal 1 receptor 178
Synonyms: LOC232959, V1rd13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232959
Homologene: 104166
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Sun1
Name: Sad1 and UNC84 domain containing 1
Synonyms: 4632417G13Rik, 5730434D03Rik, Unc84a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77053
Homologene: 11544
Arhgef26
Name: Rho guanine nucleotide exchange factor 26
Synonyms: 8430436L14Rik, 4631416L12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 622434
Homologene: 9204
Dhrs2
Name: dehydrogenase/reductase member 2
Synonyms: SDR family, 5430405K24Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71412
Homologene: 69438
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
Frk
Name: fyn-related kinase
Synonyms: BSK/IYK, GTK
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14302
VEGA: 10
HGNC: HGNC:3955
Homologene: 48065
Gsg1l
Name: GSG1-like
Synonyms: G630023A01Rik, C230098I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269994
Homologene: 78152
Vmn1r17
Name: vomeronasal 1 receptor 17
Synonyms: V1rc16
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171189
Homologene: 115643
Cyp2c38
Name: cytochrome P450, family 2, subfamily c, polypeptide 38
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13097
Homologene: 117948
Tktl2
Name: transketolase-like 2
Synonyms: 4933401I19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74419
Homologene: 69456
Cabyr
Name: calcium binding tyrosine phosphorylation regulated
Synonyms: FSP-2, CBP86, 4933421A18Rik, 1700016C01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71132
Homologene: 49299
Pde6d
Name: phosphodiesterase 6D, cGMP-specific, rod, delta
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18582
HGNC: HGNC:8788
Homologene: 1954
Gm10608
Name: predicted gene 10608
Synonyms: EG546165
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546165
VEGA: 9
Or4f60
Name: olfactory receptor family 4 subfamily F member 60
Synonyms: GA_x6K02T2Q125-73119859-73118924, MOR245-23, Olfr1313
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258257
Homologene: 106834
Gm5699
Name: predicted gene 5699
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 435616
Ifit3
Name: interferon-induced protein with tetratricopeptide repeats 3
Synonyms: Ifi49
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15959
HGNC: HGNC:5411
Homologene: 1189
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 30,998,792 bp
  • T to C, chromosome 1 at 86,547,526 bp
  • T to C, chromosome 1 at 153,465,699 bp
  • G to T, chromosome 2 at 32,244,240 bp
  • T to G, chromosome 2 at 67,509,049 bp
  • G to T, chromosome 2 at 91,995,444 bp
  • A to G, chromosome 2 at 111,316,116 bp
  • C to A, chromosome 2 at 112,071,975 bp
  • T to C, chromosome 3 at 62,377,616 bp
  • T to A, chromosome 3 at 85,665,968 bp
  • C to T, chromosome 3 at 100,948,264 bp
  • A to G, chromosome 3 at 135,241,021 bp
  • A to T, chromosome 5 at 50,013,391 bp
  • A to G, chromosome 5 at 100,363,817 bp
  • T to C, chromosome 5 at 114,042,238 bp
  • T to C, chromosome 5 at 139,235,601 bp
  • A to G, chromosome 6 at 57,360,783 bp
  • A to G, chromosome 6 at 85,678,140 bp
  • A to G, chromosome 6 at 116,227,493 bp
  • A to G, chromosome 7 at 23,893,906 bp
  • T to A, chromosome 7 at 25,349,019 bp
  • C to T, chromosome 7 at 125,891,680 bp
  • A to T, chromosome 8 at 33,574,885 bp
  • T to A, chromosome 8 at 66,513,206 bp
  • A to T, chromosome 8 at 105,774,631 bp
  • CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA, chromosome 9 at 119,160,716 bp
  • G to C, chromosome 10 at 33,909,202 bp
  • G to A, chromosome 10 at 34,607,954 bp
  • T to C, chromosome 10 at 62,879,621 bp
  • T to C, chromosome 10 at 128,488,159 bp
  • T to C, chromosome 10 at 130,425,212 bp
  • C to T, chromosome 11 at 90,266,085 bp
  • T to C, chromosome 11 at 100,041,021 bp
  • T to C, chromosome 12 at 75,468,616 bp
  • G to T, chromosome 12 at 79,265,683 bp
  • T to C, chromosome 14 at 24,166,190 bp
  • A to T, chromosome 14 at 50,827,054 bp
  • G to T, chromosome 14 at 55,239,844 bp
  • T to G, chromosome 15 at 80,880,247 bp
  • T to A, chromosome 16 at 73,004,737 bp
  • T to C, chromosome 18 at 12,750,966 bp
  • A to T, chromosome 19 at 34,587,240 bp
  • T to C, chromosome 19 at 39,401,701 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3084 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040573-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.