Strain Name:
C57BL/6J-MtgxR3117Btlr/Mmmh
Stock Number:
040590-MU
Citation ID:
RRID:MMRRC_040590-MU
Other Names:
R3117 (G1), C57BL/6J-MtgxR3117Btlr
Major Collection:

Strain Information

Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Magi1
Name: membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms: WWP3, Gukmi1, AIP3, BAP1, Baiap1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14924
HGNC: HGNC:946
Homologene: 31257
Ttc3
Name: tetratricopeptide repeat domain 3
Synonyms: TPRD, D16Ium21, 2610202A04Rik, D16Ium21e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22129
Homologene: 2487
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Rsbn1l
Name: round spermatid basic protein 1-like
Synonyms: 8430412F05Rik, C330002G24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242860
Homologene: 19435
Prpf39
Name: pre-mRNA processing factor 39
Synonyms: Srcs1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328110
Homologene: 32377
Hacd3
Name: 3-hydroxyacyl-CoA dehydratase 3
Synonyms: B-ind1, Hspc121, Ptplad1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57874
VEGA: 9
Homologene: 9494
Nlrc4
Name: NLR family, CARD domain containing 4
Synonyms: 9530011P19Rik, Card12, Ipaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268973
VEGA: 17
Homologene: 10924
Man1a
Name: mannosidase 1, alpha
Synonyms: PCR1, mannosyl-oligosaccharide alpha-1,2-mannosidase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17155
HGNC: HGNC:6821
Homologene: 4316
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435626
Homologene: 52359
Dglucy
Name: D-glutamate cyclase
Synonyms: 9030617O03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217830
Homologene: 11798
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
AW551984
Name: expressed sequence AW551984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244810
HGNC: HGNC:6658
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Pbld2
Name: phenazine biosynthesis-like protein domain containing 2
Synonyms: 3110049J23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67307
Ulbp3
Name: UL16 binding protein 3
Synonyms: 9230019H11Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 215728
VEGA: 10
Sel1l2
Name: sel-1 suppressor of lin-12-like 2 (C. elegans)
Synonyms: LOC228684
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228684
Homologene: 16802
Or7g35
Name: olfactory receptor family 7 subfamily G member 35
Synonyms: GA_x6K02T2PVTD-13330461-13331399, MOR148-1, Olfr855
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258517
HGNC: HGNC:8466
Homologene: 74176
Mkrn3
Name: makorin, ring finger protein, 3
Synonyms: D7H15S9-1, Zfp127
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22652
HGNC: HGNC:7114
Homologene: 4143
Mlc1
Name: megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human)
Synonyms: WKL1, Kiaa0027-hp
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170790
Homologene: 15775
Filip1l
Name: filamin A interacting protein 1-like
Synonyms: 4631422O05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78749
Homologene: 37121
Hsfy2
Name: heat shock transcription factor, Y-linked 2
Synonyms: 4933413G11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71066
Homologene: 134090
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 56,637,106 bp
  • T to C, chromosome 1 at 74,147,663 bp
  • A to T, chromosome 2 at 140,240,885 bp
  • T to C, chromosome 3 at 105,986,452 bp
  • A to T, chromosome 5 at 20,927,608 bp
  • G to A, chromosome 5 at 96,771,712 bp
  • GAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA to GAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA, chromosome 6 at 93,693,932 bp
  • CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA to CGGCATTGGCACTGGCATTGGCA, chromosome 7 at 62,419,214 bp
  • A to T, chromosome 9 at 19,584,941 bp
  • T to C, chromosome 9 at 39,593,360 bp
  • G to T, chromosome 9 at 64,998,309 bp
  • G to A, chromosome 9 at 75,266,194 bp
  • G to A, chromosome 9 at 119,143,903 bp
  • A to G, chromosome 10 at 3,126,446 bp
  • T to A, chromosome 10 at 54,030,794 bp
  • A to G, chromosome 10 at 63,054,436 bp
  • T to C, chromosome 10 at 86,724,320 bp
  • T to C, chromosome 12 at 65,057,877 bp
  • A to G, chromosome 12 at 100,838,678 bp
  • A to C, chromosome 13 at 98,777,438 bp
  • T to C, chromosome 15 at 88,976,528 bp
  • T to C, chromosome 16 at 57,506,732 bp
  • G to A, chromosome 16 at 94,442,563 bp
  • C to T, chromosome 17 at 32,158,115 bp
  • T to C, chromosome 17 at 34,735,396 bp
  • T to C, chromosome 17 at 74,436,068 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3117 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040590-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.