Strain Name:
C57BL/6J-MtgxR3123Btlr/Mmmh
Stock Number:
040596-MU
Citation ID:
RRID:MMRRC_040596-MU
Other Names:
R3123 (G1), C57BL/6J-MtgxR3123Btlr
Major Collection:

Strain Information

Tnpo1
Name: transportin 1
Synonyms: D13Ertd688e, Kpnb2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238799
HGNC: HGNC:6401
Homologene: 5358
Upf1
Name: UPF1 RNA helicase and ATPase
Synonyms: PNORF-1, B430202H16Rik, Rent1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19704
HGNC: HGNC:9962
Homologene: 2185
Hsd17b12
Name: hydroxysteroid (17-beta) dehydrogenase 12
Synonyms: KIK-I, 2610510O05Rik, keratoadhesin, keratonectin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56348
Homologene: 95094
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Taf15
Name: TATA-box binding protein associated factor 15
Synonyms: TAFII68, 2610111C21Rik, Taf2n, 68kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70439
Homologene: 131088
Dhx9
Name: DExH-box helicase 9
Synonyms: leukophysin, nuclear DNA helicase II, RNA helicase, Ddx9, NDH II, NDHII, RHA
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13211
HGNC: HGNC:2750
Homologene: 1039
Trappc9
Name: trafficking protein particle complex 9
Synonyms: 4632408O18Rik, 2900005P22Rik, Nibp, TRS130, 1810044A24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Rbm27
Name: RNA binding motif protein 27
Synonyms: Psc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225432
VEGA: 18
Homologene: 35410
F2rl3
Name: F2R like thrombin or trypsin receptor 3
Synonyms: PAR4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14065
HGNC: HGNC:3540
Homologene: 36148
Casc3
Name: exon junction complex subunit
Synonyms: Btz, Mln51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192160
Homologene: 7208
Htt
Name: huntingtin
Synonyms: huntingtin, HD, htt, IT15, C430023I11Rik, Hdh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Ctsa
Name: cathepsin A
Synonyms: PPCA, Ppgb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19025
HGNC: HGNC:9251
Homologene: 80163
Nop2
Name: NOP2 nucleolar protein
Synonyms: 120kDa, Nol1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110109
HGNC: HGNC:7867
Homologene: 135865
Zfp574
Name: zinc finger protein 574
Synonyms: A630056B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232976
Homologene: 11238
Ppwd1
Name: peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms: A330090G21Rik, 4632422M10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238831
VEGA: 13
Homologene: 9099
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Ptpn4
Name: protein tyrosine phosphatase, non-receptor type 4
Synonyms: hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), TEP/mPTPMEG, testis-enriched phosphatase, TEP, PTPMEG
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19258
HGNC: HGNC:9656
Homologene: 2120
Atp4a
Name: ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms: H+K+-transporting alpha 1, H+/K+-ATPase alpha
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11944
HGNC: HGNC:819
Homologene: 68081
Pthlh
Name: parathyroid hormone-like peptide
Synonyms: Pthrp, parathyroid hormone-like hormone, PTH-like, PTH-related peptide, parathyroid hormone-related peptide, parathyroid hormone-related protein
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19227
HGNC: HGNC:9607
Homologene: 2113
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Kdm5d
Name: lysine demethylase 5D
Synonyms: Smcy, Jarid1d, HY
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 20592
Homologene: 55838
Ralgps1
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGPS1A, RALGEF2, 5830418G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241308
Homologene: 65163
Lonp1
Name: lon peptidase 1, mitochondrial
Synonyms: LON, 1200017E13Rik, Prss15
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74142
VEGA: 17
HGNC: HGNC:9479
Homologene: 3521
D930020B18Rik
Name: RIKEN cDNA D930020B18 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216393
Homologene: 87610
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214593
Homologene: 9689
Gpr75
Name: G protein-coupled receptor 75
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237716
HGNC: HGNC:4526
Homologene: 4945
Fem1b
Name: fem 1 homolog b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14155
VEGA: 9
HGNC: HGNC:3649
Homologene: 7714
Gm9839
Name: predicted gene 9839
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 408192
Homologene: 130042
Caskin2
Name: CASK-interacting protein 2
Synonyms: 1600028L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 140721
Homologene: 32485
Or10ag53
Name: olfactory receptor family 10 subfamily AG member 53
Synonyms: GA_x6K02T2Q125-48736906-48737886, MOR273-4P, MOR264-20, MOR273-4P, Olfr1530-ps1, Olfr1115
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258294
Homologene: 27114
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Tas2r140
Name: taste receptor, type 2, member 140
Synonyms: TRB3, TRB5, mTRB3, Tas2r40, T2R40, mt2r64, Tas2r13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387616
Homologene: 87013
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Dcaf8l
Name: DDB1 and CUL4 associated factor 8 like
Synonyms: PC326, PC231, Pex3, Pet2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 18630
Homologene: 137214
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: A430041B07Rik, Fam179b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328108
VEGA: 12
Homologene: 15025
Glra3
Name: glycine receptor, alpha 3 subunit
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 110304
HGNC: HGNC:4328
Homologene: 142
Cyp2j8
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: OTTMUSG00000007938, Cyp2j8-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665095
HGNC: HGNC:2634
Homologene: 133819
Or2l13
Name: olfactory receptor family 2 subfamily L member 13
Synonyms: GA_x54KRFPKG5P-15934912-15935850, MOR270-1, Olfr166
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259071
Homologene: 88350
Tgfbr2
Name: transforming growth factor, beta receptor II
Synonyms: TbetaR-II, TbetaRII, 1110020H15Rik, TBR-II
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21813
VEGA: 9
Homologene: 2435
Or2y3
Name: olfactory receptor family 2 subfamily Y member 3
Synonyms: GA_x6K02T2PSCP-2531299-2530355, MOR256-4, Olfr131
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258867
Homologene: 105889
Rad18
Name: RAD18 E3 ubiquitin protein ligase
Synonyms: 2810024C04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58186
Homologene: 48572
Mcpt8
Name: mast cell protease 8
Synonyms: MMCP-8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17231
VEGA: 14
Prr30
Name: proline rich 30
Synonyms: 1700110M21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76627
Homologene: 130773
Dach2
Name: dachshund family transcription factor 2
Synonyms: 9430028N04Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 93837
Homologene: 33472
Ifi27l2b
Name: interferon, alpha-inducible protein 27 like 2B
Synonyms: 1810023F06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217845
Homologene: 137395
Csn1s2b
Name: casein alpha s2-like B
Synonyms: Csne, Csnd
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12992
Homologene: 49221
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 32,519,777 bp
  • A to G, chromosome 1 at 119,765,423 bp
  • T to C, chromosome 1 at 153,465,706 bp
  • T to C, chromosome 2 at 33,158,956 bp
  • A to T, chromosome 2 at 87,252,791 bp
  • C to T, chromosome 2 at 94,033,958 bp
  • A to G, chromosome 2 at 122,281,073 bp
  • T to A, chromosome 2 at 164,835,232 bp
  • G to A, chromosome 4 at 96,501,213 bp
  • T to C, chromosome 5 at 34,804,531 bp
  • T to C, chromosome 5 at 87,819,058 bp
  • A to G, chromosome 6 at 48,029,116 bp
  • A to T, chromosome 6 at 112,681,346 bp
  • G to A, chromosome 6 at 125,132,201 bp
  • T to A, chromosome 6 at 133,055,241 bp
  • A to T, chromosome 6 at 147,263,291 bp
  • G to T, chromosome 7 at 25,081,601 bp
  • G to A, chromosome 7 at 30,720,225 bp
  • A to G, chromosome 8 at 56,125,209 bp
  • A to G, chromosome 8 at 70,337,483 bp
  • T to C, chromosome 8 at 72,763,212 bp
  • CGG to CG, chromosome 9 at 37,411,490 bp
  • T to C, chromosome 9 at 62,796,554 bp
  • G to A, chromosome 9 at 116,110,069 bp
  • T to A, chromosome 10 at 121,678,442 bp
  • T to A, chromosome 11 at 30,891,709 bp
  • A to T, chromosome 11 at 69,735,710 bp
  • G to A, chromosome 11 at 83,504,328 bp
  • T to C, chromosome 11 at 98,810,884 bp
  • T to C, chromosome 11 at 115,804,797 bp
  • G to T, chromosome 12 at 64,966,344 bp
  • C to T, chromosome 12 at 70,248,393 bp
  • T to C, chromosome 12 at 103,451,335 bp
  • T to C, chromosome 12 at 119,447,633 bp
  • GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC, chromosome 13 at 98,867,129 bp
  • C to T, chromosome 13 at 104,213,690 bp
  • A to T, chromosome 14 at 56,083,941 bp
  • A to G, chromosome 14 at 101,198,989 bp
  • G to A, chromosome 15 at 73,025,967 bp
  • A to G, chromosome 16 at 19,487,015 bp
  • C to T, chromosome 17 at 20,540,986 bp
  • G to A, chromosome 17 at 38,082,012 bp
  • A to G, chromosome 17 at 56,626,488 bp
  • A to G, chromosome 18 at 42,327,165 bp
  • A to T, chromosome X at 89,404,721 bp
  • T to C, chromosome X at 113,819,967 bp
  • T to C, chromosome Y at 900,558 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3123 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040596-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.