Strain Name:
C57BL/6J-MtgxR3773Btlr/Mmmh
Stock Number:
040749-MU
Citation ID:
RRID:MMRRC_040749-MU
Other Names:
R3773 (G1), C57BL/6J-MtgxR3773Btlr
Major Collection:

Strain Information

Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Nup210l
Name: nucleoporin 210-like
Synonyms: 4930548O11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77595
Homologene: 28122
Matk
Name: megakaryocyte-associated tyrosine kinase
Synonyms: Ntk, HYL, CHK, Csk homologous kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17179
HGNC: HGNC:6906
Homologene: 48104
Rngtt
Name: RNA guanylyltransferase and 5'-phosphatase
Synonyms: mouse capping enzyme
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24018
Homologene: 37851
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
Homologene: 1746
Elavl2
Name: ELAV like RNA binding protein 1
Synonyms: mel-N1, Hub
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15569
HGNC: HGNC:3313
Homologene: 20930
Suco
Name: SUN domain containing ossification factor
Synonyms: osteopotentia, Opt, AI848100
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226551
HGNC: HGNC:1240
Homologene: 32212
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP-2, nuc, SREBP2, SREBP2gc, bHLHd2, lop13
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24128
Homologene: 6927
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Tsg101
Name: tumor susceptibility gene 101
Synonyms: CC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22088
Homologene: 4584
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Shisal1
Name: shisa like 1
Synonyms: 1810041L15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72301
Homologene: 28255
Grhl3
Name: grainyhead like transcription factor 3
Synonyms: Som, Get1, ct
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230824
Homologene: 18864
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, PTPsigma, RPTPsigma, Ptpt9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Apba3
Name: amyloid beta precursor protein binding family A member 3
Synonyms: Mint-3, neuronal munc18-1-interacting protein 3, neuron-specific X11L2 protein, X11gamma, lin-10, Mint 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57267
VEGA: 10
HGNC: HGNC:580
Homologene: 3591
Pes1
Name: pescadillo ribosomal biogenesis factor 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 64934
HGNC: HGNC:8848
Homologene: 5984
Gps2
Name: G protein pathway suppressor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56310
HGNC: HGNC:4550
Homologene: 49599
Riok2
Name: RIO kinase 2
Synonyms: 2010110K24Rik, 2410085M17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67045
VEGA: 17
Homologene: 6760
Cand2
Name: cullin associated and neddylation dissociated 2 (putative)
Synonyms: Tp120b, 2210404G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67088
Homologene: 41657
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Dgcr8
Name: DGCR8, microprocessor complex subunit
Synonyms: N41, D16Wis2, D16H22S788E, Gy1, D16H22S1742E, Vo59c07, DiGeorge syndrome critical region gene 8
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94223
HGNC: HGNC:2847
Homologene: 11223
Gak
Name: cyclin G associated kinase
Synonyms: D130045N16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231580
HGNC: HGNC:4113
Homologene: 3846
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Asap3
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Synonyms: UPLC1, 9430088F20Rik, Ddefl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230837
Homologene: 41190
Ska3
Name: spindle and kinetochore associated complex subunit 3
Synonyms: F630043A04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219114
VEGA: 14
Homologene: 124284
Rnf26rt
Name: ring finger protein 26, retrotransposed
Synonyms: Gm9008
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 668155
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Ttn
Name: titin
Synonyms: connectin, L56, 1100001C23Rik, mdm, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTP-BL, Ptpri, PTPL1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Camta2
Name: calmodulin binding transcription activator 2
Synonyms: Kiaa0909-hp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216874
Homologene: 9021
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Zfp251
Name: zinc finger protein 251
Synonyms: 9130001M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71591
VEGA: 15
Homologene: 87789
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: D28, PTPROt, PTP-phi, PTP-BK, PTP-U2, GLEPP1, PTP-oc, Ptpn15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Slco1a8
Name: solute carrier organic anion transporter family, member 1a8
Synonyms: Gm6614
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 625716
Homologene: 87075
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 4632403N06Rik, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Stxbp5
Name: syntaxin binding protein 5 (tomosyn)
Synonyms: 0710001E20Rik, LGL3, 4930565N16Rik, tomosyn 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78808
Homologene: 16402
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Cfap95
Name: cilia and flagella associated protein 95
Synonyms: 1700028P14Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
NCBI: 67483
VEGA: 19
Homologene: 49850
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Cdh12
Name: cadherin 12
Synonyms: Br-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 215654
HGNC: HGNC:1751
Homologene: 37873
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Frmd4a
Name: FERM domain containing 4A
Synonyms: C230040M21Rik, 2700017I06Rik, Gm13190
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209630
Homologene: 9971
Slc4a10
Name: solute carrier family 4, sodium bicarbonate cotransporter-like, member 10
Synonyms: NCBE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94229
Homologene: 23340
Ugt2b38
Name: UDP glucuronosyltransferase 2 family, polypeptide B38
Synonyms: 9430041C03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100559
Homologene: 137225
Sun1
Name: Sad1 and UNC84 domain containing 1
Synonyms: 4632417G13Rik, 5730434D03Rik, Unc84a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77053
Homologene: 11544
Ercc6l2
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2
Synonyms: 1700019D06Rik, 9330134C04Rik, 0610007P08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76251
Homologene: 32564
Zfp426
Name: zinc finger protein 426
Synonyms: KRAB1, Zfp68-rs1, Zfo61, 2900057C04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235028
Homologene: 23435
Or9q2
Name: olfactory receptor family 9 subfamily Q member 2
Synonyms: GA_x6K02T2RE5P-4127765-4126821, MOR212-1, Olfr1497
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258736
Homologene: 17373
Acsbg3
Name: acyl-CoA synthetase bubblegum family member 3
Synonyms: 1700061G19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78625
Homologene: 28378
Vmn1r60
Name: vomeronasal 1 receptor 60
Synonyms: Gm7184
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 636697
Homologene: 41799
Csgalnact2
Name: chondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms: 4632415D10Rik, Galnact2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78752
Homologene: 23109
Cyp17a1
Name: cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms: p450c17, Cyp17, steroid 17-alpha hydroxylase
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13074
HGNC: HGNC:2593
Homologene: 73875
Ddx31
Name: DEAD/H box helicase 31
Synonyms: 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227674
Homologene: 6389
Pcdhb15
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93886
HGNC: HGNC:8692
Homologene: 32429
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627576
Homologene: 115024
Upb1
Name: ureidopropionase, beta
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103149
Homologene: 9471
Gtsf2
Name: gametocyte specific factor 2
Synonyms: BC048502
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223927
VEGA: 15
Homologene: 77620
Vmn1r32
Name: vomeronasal 1 receptor 32
Synonyms: V1rc15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171188
Homologene: 115644
Nhlrc4
Name: NHL repeat containing 4
Synonyms: F430201B04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 621239
Homologene: 134625
Zfp61
Name: zinc finger protein 61
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22719
Homologene: 74923
Or1j16
Name: olfactory receptor family 1 subfamily J member 16
Synonyms: GA_x6K02T2NLDC-33334179-33335114, MOR136-7, Olfr345
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258947
Homologene: 45069
Or7a41
Name: olfactory receptor family 7 subfamily A member 41
Synonyms: IF12, MOR139-3, GA_x6K02T2QGN0-2777431-2776472, Olfr57
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18357
Homologene: 133620
Or2h2
Name: olfactory receptor family 2 subfamily H member 2
Synonyms: MOR256-21, GA_x6K02T2PSCP-1526227-1525295, Olfr90
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258469
HGNC: HGNC:8253
Homologene: 68546
Zbed4
Name: zinc finger, BED type containing 4
Synonyms: 1700009F06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223773
Homologene: 138455
Apobec4
Name: apolipoprotein B mRNA editing enzyme catalytic polypeptide-like 4
Synonyms: 4933431M11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71281
Homologene: 52415
AC120128.1
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Ilk
Name: integrin linked kinase
Synonyms: ESTM24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16202
HGNC: HGNC:6040
Homologene: 3318
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 22,421,810 bp
  • G to T, chromosome 1 at 152,756,805 bp
  • A to T, chromosome 1 at 161,843,996 bp
  • A to T, chromosome 2 at 4,590,622 bp
  • A to T, chromosome 2 at 28,840,869 bp
  • C to T, chromosome 2 at 31,360,896 bp
  • A to T, chromosome 2 at 36,640,321 bp
  • T to C, chromosome 2 at 62,263,943 bp
  • T to C, chromosome 2 at 66,483,648 bp
  • T to C, chromosome 2 at 76,771,367 bp
  • T to G, chromosome 2 at 113,582,118 bp
  • C to T, chromosome 2 at 145,860,446 bp
  • T to C, chromosome 2 at 147,061,287 bp
  • A to G, chromosome 3 at 83,898,586 bp
  • T to G, chromosome 3 at 90,119,894 bp
  • T to C, chromosome 4 at 33,330,889 bp
  • C to T, chromosome 4 at 91,264,088 bp
  • C to T, chromosome 4 at 135,555,847 bp
  • C to T, chromosome 4 at 136,227,575 bp
  • T to C, chromosome 4 at 148,044,450 bp
  • T to C, chromosome 5 at 52,582,746 bp
  • A to G, chromosome 5 at 87,424,095 bp
  • A to G, chromosome 5 at 103,477,121 bp
  • G to A, chromosome 5 at 108,582,672 bp
  • A to G, chromosome 5 at 139,238,820 bp
  • A to T, chromosome 5 at 150,398,198 bp
  • T to A, chromosome 6 at 66,553,367 bp
  • C to T, chromosome 6 at 76,496,959 bp
  • T to A, chromosome 6 at 115,785,217 bp
  • T to C, chromosome 6 at 118,126,219 bp
  • C to T, chromosome 6 at 120,002,280 bp
  • T to A, chromosome 6 at 128,555,083 bp
  • T to A, chromosome 6 at 137,443,594 bp
  • T to C, chromosome 6 at 141,972,335 bp
  • C to A, chromosome 7 at 5,544,711 bp
  • T to C, chromosome 7 at 24,295,981 bp
  • T to C, chromosome 7 at 46,889,615 bp
  • A to T, chromosome 7 at 96,694,880 bp
  • C to T, chromosome 7 at 105,741,918 bp
  • A to T, chromosome 8 at 87,780,512 bp
  • A to T, chromosome 9 at 20,473,117 bp
  • T to C, chromosome 9 at 42,330,996 bp
  • C to A, chromosome 9 at 57,140,377 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • G to A, chromosome 10 at 9,768,927 bp
  • T to A, chromosome 10 at 75,439,838 bp
  • G to A, chromosome 10 at 79,035,180 bp
  • T to A, chromosome 10 at 81,258,297 bp
  • C to A, chromosome 10 at 81,272,609 bp
  • A to G, chromosome 11 at 3,975,548 bp
  • T to C, chromosome 11 at 69,916,101 bp
  • C to T, chromosome 11 at 70,679,515 bp
  • G to A, chromosome 13 at 55,246,673 bp
  • G to A, chromosome 13 at 55,534,480 bp
  • A to G, chromosome 13 at 63,841,450 bp
  • G to A, chromosome 13 at 81,499,043 bp
  • C to T, chromosome 14 at 57,810,077 bp
  • T to C, chromosome 14 at 79,567,210 bp
  • A to T, chromosome 15 at 21,578,554 bp
  • A to G, chromosome 15 at 27,748,091 bp
  • A to G, chromosome 15 at 76,853,636 bp
  • A to G, chromosome 15 at 82,182,108 bp
  • A to T, chromosome 15 at 84,406,685 bp
  • T to C, chromosome 15 at 88,780,847 bp
  • A to G, chromosome 15 at 103,444,391 bp
  • T to C, chromosome 16 at 18,256,775 bp
  • A to G, chromosome 17 at 12,701,205 bp
  • A to G, chromosome 17 at 17,374,651 bp
  • A to G, chromosome 17 at 19,589,657 bp
  • T to A, chromosome 17 at 25,943,393 bp
  • G to T, chromosome 17 at 37,086,065 bp
  • T to C, chromosome 17 at 56,428,978 bp
  • T to C, chromosome 17 at 56,876,262 bp
  • T to A, chromosome 17 at 74,618,429 bp
  • T to C, chromosome 17 at 78,959,106 bp
  • T to C, chromosome 18 at 20,591,862 bp
  • T to A, chromosome 18 at 37,475,890 bp
  • G to A, chromosome 19 at 3,612,330 bp
  • T to A, chromosome 19 at 13,795,204 bp
  • G to T, chromosome 19 at 23,572,553 bp
  • T to G, chromosome 19 at 46,669,723 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R3773 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040749-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.