Strain Name:
C57BL/6J-MtgxR4116Btlr/Mmmh
Stock Number:
040859-MU
Citation ID:
RRID:MMRRC_040859-MU
Other Names:
R4116 (G1), C57BL/6J-MtgxR4116Btlr
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Amigo1
Name: adhesion molecule with Ig like domain 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229715
Homologene: 46421
Cyp19a1
Name: cytochrome P450, family 19, subfamily a, polypeptide 1
Synonyms: Int-5, Int5, aromatase, Ar, Cyp19, ArKO, p450arom
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13075
VEGA: 9
HGNC: HGNC:2594
Homologene: 30955
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Slc1a6
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Mtcl1
Name: microtubule crosslinking factor 1
Synonyms: t8219b25, 1110012J17Rik, Soga2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68617
Homologene: 41017
Plk4
Name: polo like kinase 4
Synonyms: Sak, Stk18
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20873
Homologene: 7962
Nomo1
Name: nodal modulator 1
Synonyms: PM5, Nomo, D7Ertd156e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 211548
Homologene: 13810
Sf3a2
Name: splicing factor 3a, subunit 2
Synonyms: SFA66, PRP11, Sap62, 66kDa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20222
Homologene: 133823
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Cast
Name: calpastatin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12380
VEGA: 13
HGNC: HGNC:1515
Homologene: 7658
Nop56
Name: NOP56 ribonucleoprotein
Synonyms: NOP56, 56kDa with KKE/D repeat, 2310044F10Rik, Nol5a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67134
Homologene: 4660
Cald1
Name: caldesmon 1
Synonyms: 4833423D12Rik, C920027I18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109624
HGNC: HGNC:1441
Homologene: 137254
Polr3c
Name: polymerase (RNA) III (DNA directed) polypeptide C
Synonyms: RPC62, RPC3, 4933407E01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74414
Homologene: 38185
Trak1
Name: trafficking protein, kinesin binding 1
Synonyms: 2310001H13Rik, hyrt
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67095
Homologene: 25103
Unc5b
Name: unc-5 netrin receptor B
Synonyms: 6330415E02Rik, Unc5h2, D10Bwg0792e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 107449
VEGA: 10
Homologene: 32538
Ccnb1
Name: cyclin B1
Synonyms: Cycb-4, Ccnb1-rs13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268697
HGNC: HGNC:1579
Homologene: 68982
Sec22a
Name: SEC22 homolog A, vesicle trafficking protein
Synonyms: 1810005C06Rik, Sec22l2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 317717
Homologene: 8246
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Wdr95
Name: WD40 repeat domain 95
Synonyms: 4930434E21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381693
Homologene: 124480
Cyp2c66
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69888
Homologene: 133566
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Slc22a29
Name: solute carrier family 22. member 29
Synonyms: D630002G06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236293
Homologene: 77136
Ankrd34c
Name: ankyrin repeat domain 34C
Synonyms: LOC330998, B230218L05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330998
Homologene: 19814
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Sema4f
Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Synonyms: Sema W
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20355
Homologene: 3147
Kprp
Name: keratinocyte expressed, proline-rich
Synonyms: 1110001M24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433619
Homologene: 54921
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Plin4
Name: perilipin 4
Synonyms: S3-12
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57435
Homologene: 69311
Foxred1
Name: FAD-dependent oxidoreductase domain containing 1
Synonyms: TEG-23, Tex23
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235169
Homologene: 9712
Mpped1
Name: metallophosphoesterase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223726
HGNC: HGNC:1306
Homologene: 15012
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Klhl30
Name: kelch-like 30
Synonyms: 4631423F02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70788
Homologene: 18891
Or7g27
Name: olfactory receptor family 7 subfamily G member 27
Synonyms: GA_x6K02T2PVTD-13076685-13077623, MOR150-1P, MOR150-2, MOR150-1P, MOR150-1, Olfr1522-ps1, Olfr845
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258249
Homologene: 133689
Zfp773
Name: zinc finger protein 773
Synonyms: 2810409K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76373
Homologene: 137393
Ccdc121rt2
Name: coiled-coil domain containing 121, retrogene 2
Synonyms: Gm6588
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 625464
Homologene: 116059
Sult2a2
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2
Synonyms: mSTa2, Sth2, C730007P19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043194
Kcnk12
Name: potassium channel, subfamily K, member 12
Synonyms: mntk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210741
VEGA: 17
HGNC: HGNC:6274
Homologene: 11107
Hoxd13
Name: homeobox D13
Synonyms: Hox-4.8, spdh
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15433
HGNC: HGNC:5136
Homologene: 20147
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 91,354,108 bp
  • C to A, chromosome 2 at 74,668,488 bp
  • T to C, chromosome 2 at 130,276,673 bp
  • T to C, chromosome 3 at 40,805,177 bp
  • A to T, chromosome 3 at 92,823,968 bp
  • A to T, chromosome 3 at 96,715,244 bp
  • C to T, chromosome 3 at 108,188,445 bp
  • A to G, chromosome 5 at 73,220,994 bp
  • A to G, chromosome 5 at 112,450,511 bp
  • C to A, chromosome 5 at 149,597,575 bp
  • C to T, chromosome 6 at 34,745,719 bp
  • T to C, chromosome 6 at 48,456,994 bp
  • G to T, chromosome 6 at 70,607,939 bp
  • G to A, chromosome 6 at 82,917,906 bp
  • AGCTGCTGCTGCTGCTGCTGCTGCTGC to AGCTGCTGCTGCTGCTGCTGCTGC, chromosome 7 at 7,133,093 bp
  • A to T, chromosome 7 at 13,734,783 bp
  • C to T, chromosome 7 at 27,391,570 bp
  • T to C, chromosome 7 at 46,033,896 bp
  • C to T, chromosome 7 at 67,734,657 bp
  • A to T, chromosome 8 at 119,541,652 bp
  • T to G, chromosome 9 at 19,338,644 bp
  • T to C, chromosome 9 at 35,205,955 bp
  • T to A, chromosome 9 at 54,168,741 bp
  • T to C, chromosome 9 at 57,140,305 bp
  • A to G, chromosome 9 at 89,729,874 bp
  • T to C, chromosome 9 at 121,448,843 bp
  • T to G, chromosome 10 at 43,999,162 bp
  • G to T, chromosome 10 at 60,774,700 bp
  • A to G, chromosome 10 at 78,787,889 bp
  • A to G, chromosome 10 at 80,801,341 bp
  • A to T, chromosome 12 at 51,768,723 bp
  • A to T, chromosome 12 at 75,931,079 bp
  • C to T, chromosome 13 at 74,724,837 bp
  • C to T, chromosome 13 at 100,781,820 bp
  • A to G, chromosome 15 at 83,796,709 bp
  • A to G, chromosome 16 at 35,318,832 bp
  • G to A, chromosome 16 at 93,873,339 bp
  • A to T, chromosome 17 at 46,323,891 bp
  • A to G, chromosome 17 at 50,920,587 bp
  • A to G, chromosome 17 at 56,102,113 bp
  • T to C, chromosome 17 at 66,366,481 bp
  • GGCATCGC to GGCATCGCATCGC, chromosome 17 at 87,746,156 bp
  • C to A, chromosome 19 at 8,169,195 bp
  • A to G, chromosome 19 at 39,176,559 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4116 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040859-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.