Strain Name:
C57BL/6J-MtgxR4117Btlr/Mmmh
Stock Number:
040991-MU
Citation ID:
RRID:MMRRC_040991-MU
Other Names:
R4117 (G1), C57BL/6J-MtgxR4117Btlr
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Bard1
Name: BRCA1 associated RING domain 1
Synonyms: ENSMUSG00000060893, ENSMUSG00000073653
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12021
HGNC: HGNC:952
Homologene: 400
Npas4
Name: neuronal PAS domain protein 4
Synonyms: LE-PAS, Nxf, Npas4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225872
VEGA: 19
Homologene: 15333
Ubxn10
Name: UBX domain protein 10
Synonyms: 5730509E04Rik, Ubxd3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212190
Homologene: 17568
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270118
Homologene: 134147
Pigg
Name: phosphatidylinositol glycan anchor biosynthesis, class G
Synonyms: Gpi7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433931
Homologene: 39421
Adamts16
Name: ADAM metallopeptidase with thrombospondin type 1 motif 16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 271127
Homologene: 15146
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Gm11492
Name: predicted gene 11492
Type: Gene
Species: Mouse
Chromosome: 11
Mrpl44
Name: mitochondrial ribosomal protein L44
Synonyms: 1810030E18Rik, 5730593H20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69163
Homologene: 11293
Tbc1d9
Name: TBC1 domain family, member 9
Synonyms: C76116, 4933431N12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71310
Homologene: 57079
Cenpt
Name: centromere protein T
Synonyms: G630055P03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320394
Homologene: 41610
Rufy4
Name: RUN and FYVE domain containing 4
Synonyms: F930048N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 435626
Homologene: 52359
Ctdnep1
Name: CTD nuclear envelope phosphatase 1
Synonyms: 2610507E10Rik, Dullard
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67181
Homologene: 9100
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
Serpinb9
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9
Synonyms: ovalbumin, PI-9, Spi6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20723
HGNC: HGNC:8955
Homologene: 37888
Vmn2r7
Name: vomeronasal 2, receptor 7
Synonyms: 4933425M15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319217
Homologene: 129754
Or51f5
Name: olfactory receptor family 51 subfamily F member 5
Synonyms: GA_x6K02T2PBJ9-5491151-5492095, MOR14-2, Olfr561
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259096
Homologene: 133029
Stmn4
Name: stathmin-like 4
Synonyms: RB3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56471
Homologene: 10496
Semp2l2b
Name: SUMO/sentrin specific peptidase 2-like 2B
Synonyms: 4930444G20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114671
Homologene: 130042
Heph
Name: hephaestin
Synonyms: sla, sex linked anemia, C130006F04Rik, Cpl
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 15203
HGNC: HGNC:4866
Homologene: 32094
Fam210b
Name: family with sequence similarity 210, member B
Synonyms: 2010011I20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 67017
Homologene: 32646
Arhgap4
Name: Rho GTPase activating protein 4
Synonyms: c1, A530015A20Rik, A130009C12Rik, Rgc1
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 171207
HGNC: HGNC:674
Homologene: 20403
She
Name: src homology 2 domain-containing transforming protein E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214547
Homologene: 18186
Zfp607b
Name: zinc finger protein 607B
Synonyms: C030039L03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 112415
Homologene: 134321
Rdh12
Name: retinol dehydrogenase 12
Synonyms: A930033N07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 77974
Homologene: 110830
Gm11127
Name: predicted gene 11127
Synonyms: Gm11127
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100529082
Homologene: 133121
Plekhg2
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2
Synonyms: Clg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101497
Homologene: 16341
Acss2
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, AceCS1, ACAS, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Stx17
Name: syntaxin 17
Synonyms: 6330411F21Rik, 4833418L03Rik, 9030425C21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67727
Homologene: 9917
Vmn2r42
Name: vomeronasal 2, receptor 42
Synonyms: V2r4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22310
Homologene: 113703
Gm26592
Name: predicted gene, 26592
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
Gm2245
Name: predicted gene 2245
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 102632231
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 71,046,763 bp
  • T to C, chromosome 1 at 74,147,663 bp
  • T to C, chromosome 1 at 79,778,164 bp
  • T to C, chromosome 2 at 155,556,393 bp
  • T to C, chromosome 2 at 172,351,566 bp
  • A to C, chromosome 3 at 64,715,717 bp
  • A to T, chromosome 3 at 89,852,372 bp
  • A to G, chromosome 4 at 48,180,689 bp
  • G to T, chromosome 4 at 138,720,965 bp
  • A to G, chromosome 5 at 108,348,042 bp
  • C to T, chromosome 6 at 35,241,012 bp
  • T to C, chromosome 7 at 8,194,840 bp
  • A to G, chromosome 7 at 27,698,682 bp
  • A to T, chromosome 7 at 28,360,888 bp
  • T to A, chromosome 7 at 102,774,477 bp
  • C to T, chromosome 7 at 110,091,913 bp
  • T to G, chromosome 8 at 83,266,147 bp
  • G to A, chromosome 8 at 105,849,700 bp
  • T to C, chromosome 8 at 125,468,510 bp
  • A to G, chromosome 9 at 13,705,934 bp
  • T to A, chromosome 9 at 21,037,590 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • T to A, chromosome 10 at 22,067,716 bp
  • C to A, chromosome 11 at 69,988,671 bp
  • T to C, chromosome 11 at 87,568,282 bp
  • C to T, chromosome 12 at 79,213,645 bp
  • T to A, chromosome 13 at 33,015,596 bp
  • A to G, chromosome 13 at 70,767,992 bp
  • T to C, chromosome 14 at 66,361,132 bp
  • A to C, chromosome 15 at 6,630,116 bp
  • T to C, chromosome 17 at 36,057,604 bp
  • T to C, chromosome 19 at 4,987,363 bp
  • G to A, chromosome X at 73,896,420 bp
  • T to C, chromosome X at 96,500,615 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4117 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
040991-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.