Strain Name:
C57BL/6J-MtgxR4246Btlr/Mmmh
Stock Number:
041062-MU
Citation ID:
RRID:MMRRC_041062-MU
Other Names:
R4246 (G1), C57BL/6J-MtgxR4246Btlr
Major Collection:

Strain Information

Snca
Name: synuclein, alpha
Synonyms: alphaSYN, alpha-synuclein, alpha-Syn
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20617
Homologene: 293
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Ccdc91
Name: coiled-coil domain containing 91
Synonyms: 1700086G08Rik, 1810060J02Rik, p56
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67015
Homologene: 10131
Jpt1
Name: Jupiter microtubule associated homolog 1
Synonyms: Hn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15374
Homologene: 7364
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Trhr
Name: thyrotropin releasing hormone receptor
Synonyms: TRH-R1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22045
VEGA: 15
Homologene: 20707
Sumf1
Name: sulfatase modifying factor 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58911
Homologene: 16268
Rnf14
Name: ring finger protein 14
Synonyms: Triad2, 2310075C09Rik, 2610005D23Rik, D18Ertd188e, D7Bwg0165e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56736
VEGA: 18
Homologene: 129170
Angptl8
Name: angiopoietin-like 8
Synonyms: Rifl, Lipasin, Gm6484
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 624219
VEGA: 9
Homologene: 83285
Nelfa
Name: negative elongation factor complex member A, Whsc2
Synonyms: Whsc2h, Nelf-A, Whsc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 24116
Homologene: 68478
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Golga2
Name: golgin A2
Synonyms: GM130
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99412
HGNC: HGNC:4425
Homologene: 3300
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Nr4a3
Name: nuclear receptor subfamily 4, group A, member 3
Synonyms: TEC, NOR-1, Nor1, MINOR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18124
HGNC: HGNC:7982
Homologene: 5074
Lamtor5
Name: late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Synonyms: 1110003H18Rik, Hbxip
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68576
Homologene: 4668
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Ppp1r3a
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140491
HGNC: HGNC:9291
Homologene: 48124
Klhl32
Name: kelch-like 32
Synonyms: LOC384000, D4Ertd389e, 6430524H05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212390
Homologene: 14173
Or5m5
Name: olfactory receptor family 5 subfamily M member 5
Synonyms: GA_x6K02T2Q125-47462755-47463693, MOR196-2, Olfr1030
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258581
Homologene: 64892
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Psd2
Name: pleckstrin and Sec7 domain containing 2
Synonyms: 6330404E20Rik, EFA6C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74002
Homologene: 12522
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Mapkbp1
Name: mitogen-activated protein kinase binding protein 1
Synonyms: Jnkbp1, 2810483F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26390
Homologene: 69109
Nrg3
Name: neuregulin 3
Synonyms: ska
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18183
HGNC: HGNC:7999
Homologene: 32051
Vill
Name: villin-like
Synonyms: Villp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22351
Homologene: 22650
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Ttll11
Name: tubulin tyrosine ligase-like family, member 11
Synonyms: 4932702F08Rik, D2Ertd624e, 4933424A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74410
Homologene: 77534
Gnal
Name: guanine nucleotide binding protein, alpha stimulating, olfactory type
Synonyms: G alpha 10, Golf, Gna10, 9630020G10Rik, 2610011C15Rik, Galphaolf
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14680
VEGA: 18
HGNC: HGNC:4388
Homologene: 68222
Lmtk3
Name: lemur tyrosine kinase 3
Synonyms: Aatyk3, AATYK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381983
Homologene: 79449
Wars2
Name: tryptophanyl tRNA synthetase 2 (mitochondrial)
Synonyms: 9430020O07Rik, TrpRS
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70560
Homologene: 5673
Or8g36
Name: olfactory receptor family 8 subfamily G member 36
Synonyms: GA_x6K02T2PVTD-33208209-33207274, MOR171-12, Olfr957
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258740
VEGA: 9
2700062C07Rik
Name: RIKEN cDNA 2700062C07 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68046
VEGA: 18
Homologene: 12230
Lrfn1
Name: leucine rich repeat and fibronectin type III domain containing 1
Synonyms: SALM2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80749
Homologene: 12729
Ak1
Name: adenylate kinase 1
Synonyms: Ak-1, B430205N08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11636
HGNC: HGNC:361
Homologene: 20135
Glyatl3
Name: glycine-N-acyltransferase-like 3
Synonyms: Gm5683
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435528
VEGA: 17
Homologene: 19824
Gm15922
Name: predicted gene 15922
Type: Gene
Species: Mouse
Chromosome: 7
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353235
HGNC: HGNC:8675
Homologene: 129614
Tuft1
Name: tuftelin 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22156
Homologene: 7985
Igkv8-21
Name: immunoglobulin kappa variable 8-21
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 6
NCBI: 620400
HGNC: HGNC:5834
Satl1
Name: spermidine/spermine N1-acetyl transferase-like 1
Synonyms: 4930404K22Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 73809
Homologene: 28332
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 136,473,388 bp
  • GTGGCT to GT, chromosome 2 at 29,154,061 bp
  • T to A, chromosome 2 at 32,299,198 bp
  • A to G, chromosome 2 at 32,633,372 bp
  • G to T, chromosome 2 at 35,979,303 bp
  • T to A, chromosome 2 at 85,984,280 bp
  • T to A, chromosome 2 at 120,013,027 bp
  • G to A, chromosome 3 at 86,126,688 bp
  • C to A, chromosome 3 at 94,614,801 bp
  • T to A, chromosome 3 at 99,216,588 bp
  • T to C, chromosome 3 at 107,279,038 bp
  • A to C, chromosome 4 at 24,800,822 bp
  • C to T, chromosome 4 at 48,083,125 bp
  • A to G, chromosome 5 at 33,899,029 bp
  • T to A, chromosome 6 at 14,719,781 bp
  • T to C, chromosome 6 at 60,733,165 bp
  • T to A, chromosome 6 at 70,315,452 bp
  • C to T, chromosome 6 at 73,129,448 bp
  • A to C, chromosome 6 at 108,155,013 bp
  • C to T, chromosome 6 at 147,592,148 bp
  • C to T, chromosome 7 at 3,737,349 bp
  • G to T, chromosome 7 at 28,459,942 bp
  • G to A, chromosome 7 at 45,794,062 bp
  • CTGATGGTGGTGGTGATGGTGGTGG to CTGATGGTGGTGG, chromosome 8 at 121,604,292 bp
  • A to T, chromosome 9 at 21,839,490 bp
  • A to G, chromosome 9 at 39,511,603 bp
  • T to C, chromosome 9 at 99,101,176 bp
  • C to A, chromosome 9 at 119,060,393 bp
  • C to T, chromosome 11 at 8,865,543 bp
  • T to C, chromosome 11 at 115,514,293 bp
  • C to A, chromosome 14 at 30,891,402 bp
  • G to A, chromosome 14 at 39,472,241 bp
  • G to A, chromosome 15 at 8,332,432 bp
  • A to T, chromosome 15 at 44,233,460 bp
  • C to T, chromosome 15 at 98,840,089 bp
  • T to A, chromosome 17 at 40,910,098 bp
  • A to G, chromosome 18 at 22,525,500 bp
  • A to G, chromosome 18 at 24,472,956 bp
  • A to G, chromosome 18 at 24,990,066 bp
  • T to C, chromosome 18 at 36,006,119 bp
  • A to G, chromosome 18 at 36,992,897 bp
  • T to A, chromosome 18 at 38,301,648 bp
  • C to G, chromosome 18 at 67,088,583 bp
  • A to G, chromosome X at 112,406,336 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4246 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041062-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.