Strain Name:
C57BL/6J-MtgxR4327Btlr/Mmmh
Stock Number:
041097-MU
Citation ID:
RRID:MMRRC_041097-MU
Other Names:
R4327 (G1), C57BL/6J-MtgxR4327Btlr
Major Collection:

Strain Information

Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Zfp934
Name: zinc finger protein 934
Synonyms: 6720457D02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77117
VEGA: 13
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Pafah1b1
Name: platelet-activating factor acetylhydrolase, isoform 1b, subunit 1
Synonyms: Lis1, LIS-1, lissencephaly-1 protein, Mdsh, Pafaha, PAF-AH 45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18472
HGNC: HGNC:8574
Homologene: 371
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212285
Homologene: 9064
Sin3a
Name: transcriptional regulator, SIN3A (yeast)
Synonyms: Sin3, mSin3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20466
Homologene: 32124
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Palm
Name: paralemmin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18483
VEGA: 10
HGNC: HGNC:8594
Homologene: 1937
Tmem161b
Name: transmembrane protein 161B
Synonyms: 2810446P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72745
Homologene: 14519
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Tonsl
Name: tonsoku-like, DNA repair protein
Synonyms: 2810439M11Rik, Nfkbil2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72749
HGNC: HGNC:7801
Homologene: 22754
St7
Name: suppression of tumorigenicity 7
Synonyms: RAY1, HELG, SEN4, TSG7, Fam4a2, 9430001H04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Klhl28
Name: kelch-like 28
Synonyms: 2810440N09Rik, 4931401E10Rik, 4122402F11Rik, Btbd5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66689
VEGA: 12
Homologene: 23036
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: CD140b, Pdgfr
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Mpp3
Name: membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
Synonyms: Dlgh3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13384
HGNC: HGNC:7221
Homologene: 31065
Ctsc
Name: cathepsin C
Synonyms: DPP1, dipeptidylpeptidase 1, DPPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13032
HGNC: HGNC:2528
Homologene: 1373
Pfkp
Name: phosphofructokinase, platelet
Synonyms: PFK-C, 1200015H23Rik, 9330125N24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56421
HGNC: HGNC:8878
Homologene: 20579
Tcf25
Name: transcription factor 25 (basic helix-loop-helix)
Synonyms: 1810041K11Rik, 1100001J13Rik, Nulp1, D8Ertd325e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66855
Homologene: 5701
Tmem107
Name: transmembrane protein 107
Synonyms: 2810049P21Rik, 1110004B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66910
Homologene: 12052
Col13a1
Name: collagen, type XIII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12817
HGNC: HGNC:2190
Homologene: 22421
Fastkd2
Name: FAST kinase domains 2
Synonyms: 2810421I24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75619
Homologene: 8957
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Treml4
Name: triggering receptor expressed on myeloid cells-like 4
Synonyms: 5031403H21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224840
Kcnq4
Name: potassium voltage-gated channel, subfamily Q, member 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 60613
HGNC: HGNC:6298
Homologene: 78107
Tigd2
Name: tigger transposable element derived 2
Synonyms: 3632410O17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68140
Homologene: 129603
Or11g27
Name: olfactory receptor family 11 subfamily G member 27
Synonyms: GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, MOR106-14, Olfr265, Olfr743-ps1, Olfr264, Olfr743
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219019
Homologene: 74163
Lingo2
Name: leucine rich repeat and Ig domain containing 2
Synonyms: B230217C06Rik, Lrrn6c, LERN3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242384
Homologene: 17621
Col16a1
Name: collagen, type XVI, alpha 1
Synonyms: [a]1 (XVI) collagen, 2700007F12Rik, A530052M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107581
HGNC: HGNC:2193
Homologene: 1397
Pcdhb9
Name: protocadherin beta 9
Synonyms: Pcdhb4C, PcdhbI
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93880
HGNC: HGNC:8689
Homologene: 87124
Ugt1a6a
Name: UDP glucuronosyltransferase 1 family, polypeptide A6A
Synonyms: UGT1.6, Ugt1a6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94284
Homologene: 85959
Zfp286
Name: zinc finger protein 286
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192651
Homologene: 56892
Arrdc5
Name: arrestin domain containing 5
Synonyms: 1700013E09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76920
VEGA: 17
Homologene: 66277
Alcam
Name: activated leukocyte cell adhesion molecule
Synonyms: DM-GRASP, CD166, MuSC, SC1, BEN
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11658
HGNC: HGNC:400
Homologene: 1229
Slc13a1
Name: solute carrier family 13 (sodium/sulfate symporters), member 1
Synonyms: NaSi-1, Nas1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 55961
Homologene: 31893
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Ip6k2
Name: inositol hexaphosphate kinase 2
Synonyms: 1500005N04Rik, Ihpk2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76500
Homologene: 56929
Pex26
Name: peroxisomal biogenesis factor 26
Synonyms: 4632428M11Rik, peroxisome biogenesis factor 26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74043
Homologene: 9922
Serpinb3a
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
Synonyms: Sqn5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20248
Homologene: 76659
Or2t1
Name: olfactory receptor family 2 subfamily T member 1
Synonyms: MTPCR53, MOR274-1, GA_x6K02T2PLTE-6714644-6715597, Olfr31
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18330
HGNC: HGNC:8277
Homologene: 74028
Zfp184
Name: zinc finger protein 184 (Kruppel-like)
Synonyms: 4930500C15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193452
Homologene: 113602
Rdm1
Name: RAD52 motif 1
Synonyms: 2410008M22Rik, Rad52b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66599
Homologene: 11992
Cyp2j8
Name: cytochrome P450, family 2, subfamily j, polypeptide 8
Synonyms: OTTMUSG00000007938, Cyp2j8-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665095
HGNC: HGNC:2634
Homologene: 133819
Cela3b
Name: chymotrypsin-like elastase family, member 3B
Synonyms: 2310074F01Rik, 0910001F22Rik, Ela3, Ela3b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67868
Homologene: 128227
Kcnn1
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Synonyms: SK1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84036
HGNC: HGNC:6290
Homologene: 37595
Or12e10
Name: olfactory receptor family 12 subfamily E member 10
Synonyms: GA_x6K02T2Q125-49311440-49312384, MOR264-19, Olfr1145
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258317
Homologene: 27123
1700019A02Rik
Name: RIKEN cDNA 1700019A02 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69397
Lhb
Name: luteinizing hormone beta
Synonyms: leutropin, LH, Gm29035
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16866
Homologene: 81806
BC068157
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
Gm12367
Name: predicted gene 12367
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 4
NCBI: 118568669
Ctcflos
Name: CCCTC-binding factor like, opposite strand
Synonyms: 1300015D01Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 74161
Mir7047
Name: microRNA 7047
Synonyms: mmu-mir-7047
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 102465634
VEGA: 7
Or52n1
Name: olfactory receptor family 52 subfamily N member 1, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-7361631-7360711, MOR34-10P, EG667918, Olfr664
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667918
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,182,505 bp
  • A to G, chromosome 1 at 63,752,357 bp
  • C to T, chromosome 1 at 88,215,788 bp
  • T to A, chromosome 1 at 107,051,770 bp
  • A to G, chromosome 2 at 66,737,471 bp
  • A to T, chromosome 2 at 82,987,059 bp
  • G to T, chromosome 2 at 87,810,152 bp
  • A to T, chromosome 2 at 121,256,650 bp
  • G to A, chromosome 2 at 173,113,506 bp
  • T to C, chromosome 3 at 59,265,267 bp
  • T to C, chromosome 3 at 86,123,713 bp
  • T to A, chromosome 4 at 35,225,985 bp
  • T to A, chromosome 4 at 35,708,462 bp
  • T to A, chromosome 4 at 96,507,329 bp
  • T to C, chromosome 4 at 120,711,364 bp
  • C to T, chromosome 4 at 123,382,212 bp
  • T to C, chromosome 4 at 130,094,551 bp
  • G to T, chromosome 4 at 137,423,931 bp
  • A to T, chromosome 5 at 62,621,863 bp
  • G to A, chromosome 6 at 17,819,288 bp
  • A to G, chromosome 6 at 24,103,479 bp
  • C to A, chromosome 6 at 59,210,577 bp
  • A to T, chromosome 6 at 121,187,414 bp
  • A to G, chromosome 7 at 24,987,631 bp
  • A to G, chromosome 7 at 45,420,959 bp
  • A to G, chromosome 7 at 88,281,412 bp
  • G to A, chromosome 7 at 104,733,626 bp
  • TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC to TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC, chromosome 8 at 4,216,273 bp
  • A to T, chromosome 8 at 70,852,663 bp
  • T to A, chromosome 8 at 123,401,143 bp
  • T to C, chromosome 9 at 57,095,358 bp
  • G to A, chromosome 9 at 108,805,648 bp
  • T to C, chromosome 10 at 61,863,979 bp
  • G to A, chromosome 10 at 79,807,686 bp
  • A to G, chromosome 11 at 62,780,018 bp
  • G to T, chromosome 11 at 69,071,475 bp
  • T to C, chromosome 11 at 74,682,240 bp
  • T to A, chromosome 11 at 101,630,908 bp
  • T to C, chromosome 11 at 102,023,511 bp
  • G to A, chromosome 12 at 64,950,178 bp
  • A to G, chromosome 13 at 6,579,773 bp
  • T to C, chromosome 13 at 21,959,902 bp
  • T to G, chromosome 13 at 62,517,559 bp
  • G to A, chromosome 13 at 84,251,240 bp
  • T to A, chromosome 14 at 14,328,193 bp
  • T to A, chromosome 14 at 50,533,514 bp
  • G to A, chromosome 15 at 76,639,716 bp
  • T to C, chromosome 16 at 52,253,216 bp
  • A to G, chromosome 16 at 89,855,891 bp
  • T to C, chromosome 17 at 48,274,389 bp
  • T to C, chromosome 17 at 56,294,420 bp
  • A to T, chromosome 18 at 37,401,822 bp
  • G to T, chromosome 18 at 37,401,823 bp
  • A to T, chromosome 18 at 61,071,720 bp
  • A to T, chromosome 18 at 61,167,539 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4327 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041097-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.