Strain Name:
C57BL/6J-MtgxR4371Btlr/Mmmh
Stock Number:
041117-MU
Citation ID:
RRID:MMRRC_041117-MU
Other Names:
R4371 (G1), C57BL/6J-MtgxR4371Btlr
Major Collection:

Strain Information

Sdf2
Name: stromal cell derived factor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20316
Homologene: 5045
Alox12b
Name: arachidonate 12-lipoxygenase, 12R type
Synonyms: e-LOX2, Aloxe2, 12R-LOX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11686
HGNC: HGNC:430
Homologene: 884
Brpf3
Name: bromodomain and PHD finger containing, 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268936
Homologene: 16092
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Tfap4
Name: transcription factor AP4
Synonyms: AP-4, D930048N17Rik, bHLHc41, Tcfap4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 83383
VEGA: 16
Homologene: 2424
Camsap2
Name: calmodulin regulated spectrin-associated protein family, member 2
Synonyms: 1600013L13Rik, 4930541M15Rik, Camsap1l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67886
Homologene: 18927
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224170
Homologene: 8771
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Hepacam2
Name: HEPACAM family member 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101202
Homologene: 18724
Ttf2
Name: transcription termination factor, RNA polymerase II
Synonyms: 4632434F22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74044
Homologene: 37826
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: MFT.M05.13, Hcapg, 5730507H05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54392
Homologene: 44071
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Flcn
Name: folliculin
Synonyms: B430214A04Rik, BHD
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216805
Homologene: 14583
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, 9930021N24Rik, Zfp220, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
H2-K1
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14972
Homologene: 128352
Sptbn5
Name: spectrin beta, non-erythrocytic 5
Synonyms: EG640524, Spnb5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 640524
Homologene: 41150
B4galt3
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms: beta4GalT-III, ESTM26, 9530061M23Rik, R74981
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57370
HGNC: HGNC:926
Homologene: 48241
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Rchy1
Name: ring finger and CHY zinc finger domain containing 1
Synonyms: PRO1996, 6720407C15Rik, Zfp363, Pirh2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68098
Homologene: 22894
Iqsec1
Name: IQ motif and Sec7 domain 1
Synonyms: cI-43, D6Ertd349e, BRAG2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232227
Homologene: 82429
Tmem168
Name: transmembrane protein 168
Synonyms: 5730526F17Rik, 8430437G11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101118
Homologene: 11202
Alg11
Name: ALG11 alpha-1,2-mannosyltransferase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 207958
Homologene: 68893
C9
Name: complement component 9
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12279
HGNC: HGNC:1358
Homologene: 74406
Gm20547
Name: predicted gene 20547
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: GA_x6K02T2PBJ9-10951546-10952496, MOR204-7, Olfr507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258738
Homologene: 27249
Ocstamp
Name: osteoclast stimulatory transmembrane protein
Synonyms: 4833422F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74614
Homologene: 41768
Epha1
Name: Eph receptor A1
Synonyms: Esk, 5730453L17Rik, Eph
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13835
HGNC: HGNC:3385
Homologene: 3835
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Phactr2
Name: phosphatase and actin regulator 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215789
Homologene: 8816
Thrb
Name: thyroid hormone receptor beta
Synonyms: T3Rbeta, T3R[b], Nr1a2, TR beta, c-erbAbeta, Thrb2, Thrb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21834
Homologene: 36025
Chfr
Name: checkpoint with forkhead and ring finger domains
Synonyms: RNF116, 5730484M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231600
Homologene: 10078
Drp2
Name: dystrophin related protein 2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 13497
HGNC: HGNC:3032
Homologene: 55620
Cyp4f14
Name: cytochrome P450, family 4, subfamily f, polypeptide 14
Synonyms: 1300014O15Rik, leukotriene B4 omega hydroxylase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64385
VEGA: 17
Homologene: 81872
Glrp1
Name: glutamine repeat protein 1
Synonyms: GRP-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14659
Bckdk
Name: branched chain ketoacid dehydrogenase kinase
Synonyms: BCKD-kinase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12041
Homologene: 37642
Gm6177
Name: predicted gene 6177
Synonyms: EG620750
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
NCBI: 620750
Sys1
Name: SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
Synonyms: 2610042O14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66460
Homologene: 43135
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 60,289,946 bp
  • GTGCTGCTGCTGCTGCTGCTGCTGCTG to GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG, chromosome 1 at 88,503,275 bp
  • A to G, chromosome 1 at 136,287,963 bp
  • A to T, chromosome 1 at 160,893,171 bp
  • C to A, chromosome 1 at 171,274,043 bp
  • A to G, chromosome 2 at 120,065,994 bp
  • A to T, chromosome 2 at 120,895,066 bp
  • G to A, chromosome 2 at 125,613,047 bp
  • T to C, chromosome 2 at 164,461,395 bp
  • A to G, chromosome 2 at 165,397,313 bp
  • T to C, chromosome 2 at 168,649,615 bp
  • C to T, chromosome 3 at 100,948,199 bp
  • T to C, chromosome 4 at 63,970,351 bp
  • G to A, chromosome 5 at 45,678,455 bp
  • T to C, chromosome 5 at 91,955,577 bp
  • G to A, chromosome 5 at 110,136,168 bp
  • A to T, chromosome 6 at 3,486,988 bp
  • C to T, chromosome 6 at 13,603,411 bp
  • T to C, chromosome 6 at 42,365,457 bp
  • A to G, chromosome 6 at 90,694,606 bp
  • C to T, chromosome 7 at 108,621,889 bp
  • C to T, chromosome 7 at 127,906,419 bp
  • C to A, chromosome 8 at 22,068,079 bp
  • T to C, chromosome 8 at 22,911,929 bp
  • A to G, chromosome 10 at 13,253,820 bp
  • C to T, chromosome 11 at 59,803,784 bp
  • G to A, chromosome 11 at 69,169,616 bp
  • C to T, chromosome 11 at 78,251,037 bp
  • T to C, chromosome 13 at 21,982,239 bp
  • C to A, chromosome 14 at 18,030,275 bp
  • A to G, chromosome 15 at 6,491,484 bp
  • A to G, chromosome 16 at 4,551,999 bp
  • A to G, chromosome 16 at 48,943,455 bp
  • C to T, chromosome 17 at 28,836,620 bp
  • T to C, chromosome 17 at 32,909,258 bp
  • C to T, chromosome 17 at 33,999,816 bp
  • T to C, chromosome 17 at 34,860,314 bp
  • A to T, chromosome X at 134,435,135 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4371 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041117-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.