Strain Name:
C57BL/6J-MtgxR4118Btlr/Mmmh
Stock Number:
041631-MU
Citation ID:
RRID:MMRRC_041631-MU
Other Names:
R4118 (G1), C57BL/6J-MtgxR4118Btlr
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Otx2
Name: orthodenticle homeobox 2
Synonyms: E130306E05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18424
HGNC: HGNC:8522
Homologene: 11026
Wwp2
Name: WW domain containing E3 ubiquitin protein ligase 2
Synonyms: 1300010O06Rik, AIP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66894
Homologene: 48490
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: D630035I23Rik, TRIP8, 5430433L24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Pds5b
Name: PDS5 cohesin associated factor B
Synonyms: AS3, Aprin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100710
Homologene: 41001
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Zfp523
Name: zinc finger protein 523
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224656
Homologene: 2569
Gmps
Name: guanine monophosphate synthetase
Synonyms: Gm9479
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229363
HGNC: HGNC:4378
Homologene: 68367
Etaa1
Name: Ewing tumor-associated antigen 1
Synonyms: 5730466H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68145
Homologene: 10369
Depdc5
Name: DEP domain containing 5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 277854
Homologene: 34718
Atp2c1
Name: ATPase, Ca++-sequestering
Synonyms: SPCA, 1700121J11Rik, ATP2C1A, PMR1, D930003G21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235574
Homologene: 56672
Ubap1
Name: ubiquitin-associated protein 1
Synonyms: 2700092A01Rik, NAG20
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67123
Homologene: 9554
Ipo5
Name: importin 5
Synonyms: RanBP5, 5730478E03Rik, 1110011C18Rik, Kpnb3, IMB3, importin beta 3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70572
VEGA: 14
HGNC: HGNC:6402
Homologene: 1710
Dek
Name: DEK proto-oncogene
Synonyms: D13H6S231E, 1810019E15Rik, DEK proto-oncogene (DNA binding)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110052
HGNC: HGNC:2768
Homologene: 2593
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Ccp110
Name: centriolar coiled coil protein 110
Synonyms: CP110, 6330503K22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101565
Homologene: 8810
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Nxf1
Name: nuclear RNA export factor 1
Synonyms: Tip associated protein, TAP, Mex67, Mvb1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53319
HGNC: HGNC:8071
Homologene: 38176
Usp54
Name: ubiquitin specific peptidase 54
Synonyms: 4930429G18Rik, C030002J06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78787
Homologene: 90902
Slmap
Name: sarcolemma associated protein
Synonyms: Slap, D330001L02Rik, Miranda
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 83997
Homologene: 31428
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Bbs4
Name: Bardet-Biedl syndrome 4
Synonyms: D9Ertd464e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102774
VEGA: 9
HGNC: HGNC:969
Homologene: 13197
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, 1700047E16Rik, fantom, Nphp8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Lrp12
Name: low density lipoprotein-related protein 12
Synonyms: C820005L12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239393
Homologene: 8385
Slc22a29
Name: solute carrier family 22. member 29
Synonyms: D630002G06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236293
Homologene: 77136
Atxn7
Name: ataxin 7
Synonyms: ataxin-7, Sca7, A430107N12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 246103
VEGA: 14
Homologene: 30967
Naglu
Name: alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27419
HGNC: HGNC:7632
Homologene: 222
Cep162
Name: centrosomal protein 162
Synonyms: 4922501C03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382090
Homologene: 8930
Arhgef4
Name: Rho guanine nucleotide exchange factor 4
Synonyms: 9330140K16Rik, Asef, C230030N03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226970
HGNC: HGNC:684
Homologene: 49414
Rpp40
Name: ribonuclease P 40 subunit
Synonyms: D8Bwg1265e, Rnasep1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208366
Homologene: 4836
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Nat2
Name: N-acetyltransferase 2 (arylamine N-acetyltransferase)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17961
Homologene: 37329
Ppm1d
Name: protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms: Wip1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53892
HGNC: HGNC:9277
Homologene: 31185
Ppox
Name: protoporphyrinogen oxidase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19044
HGNC: HGNC:9280
Homologene: 262
Myrfl
Name: myelin regulatory factor-like
Synonyms: LOC237558, Gm239
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237558
VEGA: 10
Homologene: 88588
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Dsbc1, Rcr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Sphkap
Name: SPHK1 interactor, AKAP domain containing
Synonyms: A930009L15Rik, 4930544G21Rik, SKIP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77629
Homologene: 18172
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241158
Homologene: 9561
Zswim5
Name: zinc finger SWIM-type containing 5
Synonyms: 4933426E21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74464
Homologene: 18958
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75721
Homologene: 138468
Serpinb3d
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3D
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 394252
Homologene: 130559
Paqr9
Name: progestin and adipoQ receptor family member IX
Synonyms: 1700020G04Rik, C730029A08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75552
Homologene: 18882
Slc35f1
Name: solute carrier family 35, member F1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215085
Homologene: 33552
1700003H04Rik
Name: RIKEN cDNA 1700003H04 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 384775
Gpr18
Name: G protein-coupled receptor 18
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110168
VEGA: 14
HGNC: HGNC:4472
Homologene: 18814
Gm10545
Name: predicted gene 10545
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Gm26858
Name: predicted gene, 26858
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 34,732,347 bp
  • G to A, chromosome 1 at 83,267,400 bp
  • T to C, chromosome 1 at 92,888,696 bp
  • A to T, chromosome 1 at 107,079,230 bp
  • A to G, chromosome 1 at 171,279,896 bp
  • C to T, chromosome 2 at 68,736,513 bp
  • C to T, chromosome 2 at 69,430,262 bp
  • T to C, chromosome 3 at 63,980,194 bp
  • A to G, chromosome 3 at 79,068,887 bp
  • T to C, chromosome 3 at 83,960,767 bp
  • T to C, chromosome 3 at 124,579,854 bp
  • G to A, chromosome 4 at 8,865,831 bp
  • A to T, chromosome 4 at 41,371,767 bp
  • G to A, chromosome 4 at 116,986,819 bp
  • T to A, chromosome 5 at 32,964,635 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 5 at 150,775,354 bp
  • T to C, chromosome 7 at 118,722,704 bp
  • A to G, chromosome 7 at 143,559,647 bp
  • T to C, chromosome 8 at 45,010,437 bp
  • C to A, chromosome 8 at 45,050,944 bp
  • G to A, chromosome 8 at 67,501,619 bp
  • G to A, chromosome 8 at 91,252,907 bp
  • A to G, chromosome 8 at 107,545,459 bp
  • T to C, chromosome 9 at 59,330,425 bp
  • T to C, chromosome 9 at 87,204,176 bp
  • T to A, chromosome 9 at 95,560,899 bp
  • A to G, chromosome 9 at 105,466,659 bp
  • T to C, chromosome 10 at 53,089,368 bp
  • T to A, chromosome 10 at 67,219,753 bp
  • A to G, chromosome 10 at 107,711,920 bp
  • T to A, chromosome 10 at 116,828,965 bp
  • A to T, chromosome 11 at 17,946,180 bp
  • A to G, chromosome 11 at 85,311,582 bp
  • G to A, chromosome 11 at 101,074,082 bp
  • A to G, chromosome 13 at 35,896,804 bp
  • T to C, chromosome 13 at 47,088,600 bp
  • A to T, chromosome 13 at 67,592,710 bp
  • T to C, chromosome 14 at 14,100,308 bp
  • A to G, chromosome 14 at 20,581,560 bp
  • A to T, chromosome 14 at 26,482,872 bp
  • G to A, chromosome 14 at 48,659,154 bp
  • A to G, chromosome 14 at 50,363,227 bp
  • A to G, chromosome 14 at 120,938,661 bp
  • T to C, chromosome 14 at 121,912,556 bp
  • A to T, chromosome 15 at 39,877,965 bp
  • C to T, chromosome 16 at 89,877,033 bp
  • T to G, chromosome 17 at 15,544,013 bp
  • T to A, chromosome 17 at 18,110,096 bp
  • A to T, chromosome 17 at 28,201,313 bp
  • C to T, chromosome 17 at 32,369,357 bp
  • T to A, chromosome 18 at 12,450,431 bp
  • G to A, chromosome 18 at 37,012,444 bp
  • T to C, chromosome 18 at 80,749,829 bp
  • A to C, chromosome 19 at 8,160,529 bp
  • C to T, chromosome 19 at 8,769,094 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4118 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041631-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.