Strain Name:
C57BL/6J-MtgxR4527Btlr/Mmmh
Stock Number:
041768-MU
Citation ID:
RRID:MMRRC_041768-MU
Other Names:
R4527 (G1), C57BL/6J-MtgxR4527Btlr
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Crhr2
Name: corticotropin releasing hormone receptor 2
Synonyms: Crfr2, CRF-R2, CRFR2beta, CRFR2alpha, CRF 2 receptor, CRH-R2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12922
HGNC: HGNC:2358
Homologene: 55612
Rnf10
Name: ring finger protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50849
Homologene: 40990
Usp5
Name: ubiquitin specific peptidase 5 (isopeptidase T)
Synonyms: Ucht
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22225
Homologene: 55758
Xrcc5
Name: X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms: Ku80, Ku86
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22596
VEGA: 1
Homologene: 40681
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Rab11fip3
Name: RAB11 family interacting protein 3 (class II)
Synonyms: Rab11-FIP3, D030060O14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 215445
Homologene: 49396
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Olfm4
Name: olfactomedin 4
Synonyms: LOC239192, LOC380924, GC1, OlfD, GW112, pPD4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380924
VEGA: 14
Homologene: 4684
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Rab11a
Name: RAB11A, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53869
HGNC: HGNC:9760
Homologene: 37903
Gorab
Name: golgin, RAB6-interacting
Synonyms: NTKL-BP1, Scyl1bp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98376
Homologene: 45113
Taf4b
Name: TATA-box binding protein associated factor 4b
Synonyms: Taf2c2, TAFII105, 105kDa, 2610524B04Rik, 4932409F03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72504
VEGA: 18
Homologene: 28266
Pask
Name: PAS domain containing serine/threonine kinase
Synonyms: Paskin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269224
Homologene: 9038
Flt3
Name: FMS-like tyrosine kinase 3
Synonyms: CD135, Flk-2, Flt-3, Flk2, wmfl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14255
HGNC: HGNC:3765
Homologene: 3040
Ttyh1
Name: tweety family member 1
Synonyms: tty, 6330408P11Rik, 4930459B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57776
Homologene: 10779
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Agfg2
Name: ArfGAP with FG repeats 2
Synonyms: A630095P14Rik, Hrbl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231801
HGNC: HGNC:5177
Homologene: 4430
Vmn2r70
Name: vomeronasal 2, receptor 70
Synonyms: EG620835
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 670940
Homologene: 115466
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Slc8a3
Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms: Ncx3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110893
Homologene: 62645
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Car2
Name: carbonic anhydrase 2
Synonyms: CAII, CA II, Ltw-5, Car-2, Lvtw-5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12349
HGNC: HGNC:1373
Homologene: 37256
Asb3
Name: ankyrin repeat and SOCS box-containing 3
Synonyms: 2400011J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 65257
Homologene: 9391
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Zscan25
Name: zinc finger and SCAN domain containing 25
Synonyms: EG666311, Zfp498
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666311
Homologene: 64820
Cer1
Name: cerberus 1, DAN family BMP antagonist
Synonyms: Cerberus-like, Cerr1, cer-1, Cerl, Cerl1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12622
HGNC: HGNC:1862
Homologene: 3983
Rps4l-ps
Name: ribosomal protein S4-like, pseudogene
Synonyms: Gm6816
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 627967
Mak16
Name: MAK16 homolog
Synonyms: 2600016B03Rik, Rbm13
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67920
Homologene: 5296
Gm16130
Name: predicted gene 16130
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 330951
Gm26908
Name: predicted gene, 26908
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 102636905
VEGA: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,855,423 bp
  • G to A, chromosome 1 at 46,532,931 bp
  • C to A, chromosome 1 at 72,312,500 bp
  • A to G, chromosome 1 at 93,320,502 bp
  • T to G, chromosome 1 at 163,397,136 bp
  • A to T, chromosome 2 at 52,193,237 bp
  • T to C, chromosome 2 at 130,973,504 bp
  • C to T, chromosome 3 at 14,898,005 bp
  • C to T, chromosome 4 at 72,157,463 bp
  • A to G, chromosome 4 at 82,884,669 bp
  • C to T, chromosome 4 at 152,135,649 bp
  • T to C, chromosome 5 at 115,260,151 bp
  • A to G, chromosome 5 at 137,684,536 bp
  • T to C, chromosome 5 at 145,283,458 bp
  • T to A, chromosome 5 at 147,356,353 bp
  • T to A, chromosome 6 at 55,132,853 bp
  • C to G, chromosome 6 at 124,822,630 bp
  • A to T, chromosome 7 at 4,119,764 bp
  • A to T, chromosome 7 at 44,354,590 bp
  • A to T, chromosome 7 at 85,559,579 bp
  • A to G, chromosome 7 at 105,682,806 bp
  • C to T, chromosome 7 at 114,927,168 bp
  • A to T, chromosome 7 at 143,565,049 bp
  • G to A, chromosome 8 at 31,166,177 bp
  • C to T, chromosome 9 at 58,032,976 bp
  • A to G, chromosome 9 at 64,725,568 bp
  • CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT, chromosome 9 at 78,712,500 bp
  • T to A, chromosome 11 at 23,421,257 bp
  • A to G, chromosome 11 at 31,058,933 bp
  • T to C, chromosome 12 at 81,315,853 bp
  • A to C, chromosome 14 at 70,207,617 bp
  • C to T, chromosome 14 at 80,021,224 bp
  • T to C, chromosome 16 at 32,755,843 bp
  • T to C, chromosome 17 at 26,036,657 bp
  • T to C, chromosome 18 at 14,821,442 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4527 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041768-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.