Strain Name:
C57BL/6J-MtgxR4673Btlr/Mmmh
Stock Number:
041928-MU
Citation ID:
RRID:MMRRC_041928-MU
Other Names:
R4673 (G1), C57BL/6J-MtgxR4673Btlr
Major Collection:

Strain Information

Rnd3
Name: Rho family GTPase 3
Synonyms: 2610017M01Rik, Arhe, Rhoe
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74194
HGNC: HGNC:671
Homologene: 21074
Rnf10
Name: ring finger protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50849
Homologene: 40990
Crlf3
Name: cytokine receptor-like factor 3
Synonyms: cytor4, Creme9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54394
Homologene: 9327
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Pibf1
Name: progesterone immunomodulatory binding factor 1
Synonyms: 1700017E21Rik, 4933438D16Rik, 4933439E17Rik, 4930513H15Rik, D14Ertd581e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52023
VEGA: 14
Homologene: 4628
Snd1
Name: staphylococcal nuclease and tudor domain containing 1
Synonyms: p100 co-activator, Tudor-SN
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56463
Homologene: 8665
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Tpr
Name: translocated promoter region, nuclear basket protein
Synonyms: 2610029M07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108989
Homologene: 37753
Scaf8
Name: SR-related CTD-associated factor 8
Synonyms: A930036P18Rik, A630086M08Rik, Rbm16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106583
VEGA: 17
Homologene: 8928
Usp34
Name: ubiquitin specific peptidase 34
Synonyms: A530081C03Rik, Murr2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17847
Homologene: 40978
Gstz1
Name: glutathione transferase zeta 1 (maleylacetoacetate isomerase)
Synonyms: maleylacetoacetate isomerase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14874
VEGA: 12
HGNC: HGNC:4643
Homologene: 7747
Bcdin3d
Name: BCDIN3 domain containing
Synonyms: 4930556P03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75284
VEGA: 15
Homologene: 12594
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: NMHC II-C, 2400004E04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71960
Homologene: 23480
Plxna3
Name: plexin A3
Synonyms: Plxn4, SEX, Plxn3, Plxa3, PlexA3
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 18846
HGNC: HGNC:9101
Homologene: 7481
Robo2
Name: roundabout guidance receptor 2
Synonyms: 9430089E08Rik, D230004I22Rik, 2600013A04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Cux2
Name: cut-like homeobox 2
Synonyms: Cux-2, Cux2, ENSMUSG00000072641, Cutl2, 1700051K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13048
Homologene: 22426
Adam32
Name: a disintegrin and metallopeptidase domain 32
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 353188
Homologene: 17021
Alas1
Name: aminolevulinic acid synthase 1
Synonyms: 5-aminolevulinate synthase, succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11655
HGNC: HGNC:396
Homologene: 55478
Gpn3
Name: GPN-loop GTPase 3
Synonyms: A930018B01Rik, D5Ertd708e, Atpbd1c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68080
Homologene: 6487
Tspan3
Name: tetraspanin 3
Synonyms: TM4-A, Tspan-3, tetraspanin, tetraspanin TM4-A homolog, 1700055K04Rik, Tm4sf8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56434
VEGA: 9
Homologene: 21168
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Zfp940
Name: zinc finger protein 940
Synonyms: BC027344
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233057
Homologene: 138421
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623474
Homologene: 8240
Shisa2
Name: shisa family member 2
Synonyms: 9430059P22Rik, shisa, mShisa, Tmem46, MAd2
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 14
NCBI: 219134
VEGA: 14
Homologene: 17078
Strbp
Name: spermatid perinuclear RNA binding protein
Synonyms: Spnr, 6430510M02Rik, C230082I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20744
Homologene: 7548
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: 9930021J17Rik, Fam160a1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Creb3
Name: cAMP responsive element binding protein 3
Synonyms: LZIP-2, LZIP-1, Luman, LZIP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12913
HGNC: HGNC:2347
Homologene: 31375
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Wdr87-ps
Name: WD repeat domain 87, pseudogene
Synonyms: 4932431P20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
NCBI: 114675
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Arhgap29
Name: Rho GTPase activating protein 29
Synonyms: 6720461J18Rik, Parg1, C76601, B130017I01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214137
Homologene: 3539
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Tnfaip3
Name: tumor necrosis factor, alpha-induced protein 3
Synonyms: A20, zinc finger protein A20, Tnfip3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21929
Homologene: 4582
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Ucp1
Name: uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms: Slc25a7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22227
Homologene: 22524
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Gtf3c5
Name: general transcription factor IIIC, polypeptide 5
Synonyms: TFiiiC2-63, TFIIICepsilon, TFIIIC63, 2700084A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70239
HGNC: HGNC:4668
Homologene: 40806
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Kynu
Name: kynureninase
Synonyms: 4432411A05Rik, L-kynurenine hydrolase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70789
HGNC: HGNC:6469
Homologene: 2925
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218165
VEGA: 13
Homologene: 125376
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Parp6
Name: poly (ADP-ribose) polymerase family, member 6
Synonyms: 2310028P13Rik, 1700119G14Rik, C030013N01Rik, 3110038K10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67287
VEGA: 9
Homologene: 10627
Adamdec1
Name: ADAM-like, decysin 1
Synonyms: 2210414L24Rik, Dcsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58860
VEGA: 14
Homologene: 8711
Rgs22
Name: regulator of G-protein signalling 22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626596
Homologene: 75047
Ogg1
Name: 8-oxoguanine DNA-glycosylase 1
Synonyms: Mmh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18294
HGNC: HGNC:8125
Homologene: 1909
Or5b24
Name: olfactory receptor family 5 subfamily B member 24
Synonyms: GA_x6K02T2RE5P-3264213-3265157, MOR202-34, Olfr1449
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258300
Homologene: 17184
Rnf207
Name: ring finger protein 207
Synonyms: D330010C22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433809
Homologene: 19234
Aldh3a1
Name: aldehyde dehydrogenase family 3, subfamily A1
Synonyms: Ahd-4, Ahd4, Aldh3, Aldh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11670
HGNC: HGNC:405
Homologene: 20175
Zpld2
Name: zona pellucida like domain containing 2
Synonyms: Gm7534
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 665186
Homologene: 104039
Or7g35
Name: olfactory receptor family 7 subfamily G member 35
Synonyms: GA_x6K02T2PVTD-13330461-13331399, MOR148-1, Olfr855
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258517
HGNC: HGNC:8466
Homologene: 74176
Hspa2
Name: heat shock protein 2
Synonyms: 70kDa, Hsp70-2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15512
VEGA: 12
HGNC: HGNC:5235
Homologene: 68564
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4, Olfr181
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259001
Homologene: 74112
Adam4
Name: a disintegrin and metallopeptidase domain 4
Synonyms: tMDCV
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11498
Homologene: 86950
Gm6483
Name: predicted gene 6483
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 8
NCBI: 624198
Casd1
Name: CAS1 domain containing 1
Synonyms: Cast1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213819
Homologene: 11287
Syf2
Name: SYF2 homolog, RNA splicing factor (S. cerevisiae)
Synonyms: p29, mp29, 1110018L13Rik, D4Bwg1551e, Gcipip, Cbpin, Ntc31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68592
Homologene: 5993
Fsbp
Name: fibrinogen silencer binding protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100503583
Homologene: 132087
Thap4
Name: THAP domain containing 4
Synonyms: 2010320B01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67026
Homologene: 12075
Septin12
Name: septin 12
Synonyms: 1700028G04Rik, 4933413B09Rik, Septin12, Sept12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71089
VEGA: 16
Homologene: 69435
Il27
Name: interleukin 27
Synonyms: p28, IL-27, Il30, IL-27p28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246779
Homologene: 17087
Krtap31-3
Name: keratin associated protein 31-3
Synonyms: Gm11565
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 11
NCBI: 670550
Homologene: 134336
Or6e1
Name: olfactory receptor family 6 subfamily E member 1
Synonyms: IC6, MOR118-1, GA_x6K02T2QVSB-39745261-39746202, Olfr49
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18348
Homologene: 106373
Or13c7c
Name: olfactory receptor family 13 subfamily C member 7C
Synonyms: OR37C, mOR37c, Olfr37c, GA_x6K02T2N78B-16110014-16110970, MOR262-12, Olfr157
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100040268
Homologene: 133619
4833413E03Rik
Name: RIKEN cDNA 4833413E03 gene
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 17
Ppp1r2-ps9
Name: protein phosphatase 1, regulatory (inhibitor) subunit 2, pseudogene 9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 67395
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 60,329,390 bp
  • T to C, chromosome 1 at 93,714,866 bp
  • G to A, chromosome 1 at 150,423,567 bp
  • A to G, chromosome 1 at 174,191,062 bp
  • A to G, chromosome 2 at 24,631,944 bp
  • A to G, chromosome 2 at 28,572,224 bp
  • A to T, chromosome 2 at 37,645,679 bp
  • A to G, chromosome 2 at 43,679,803 bp
  • G to A, chromosome 2 at 51,132,541 bp
  • A to G, chromosome 2 at 135,932,271 bp
  • G to A, chromosome 2 at 180,199,266 bp
  • A to T, chromosome 3 at 85,730,713 bp
  • T to A, chromosome 3 at 122,014,971 bp
  • T to G, chromosome 4 at 11,579,841 bp
  • T to A, chromosome 4 at 11,609,449 bp
  • T to C, chromosome 4 at 43,563,192 bp
  • T to C, chromosome 4 at 43,836,430 bp
  • G to A, chromosome 4 at 134,200,347 bp
  • A to G, chromosome 4 at 134,934,493 bp
  • C to T, chromosome 4 at 139,410,716 bp
  • T to A, chromosome 4 at 152,318,462 bp
  • A to T, chromosome 5 at 115,251,089 bp
  • G to T, chromosome 5 at 121,887,476 bp
  • A to G, chromosome 5 at 122,373,918 bp
  • A to G, chromosome 6 at 4,629,975 bp
  • A to G, chromosome 6 at 11,992,057 bp
  • T to C, chromosome 6 at 28,724,921 bp
  • T to C, chromosome 6 at 113,327,307 bp
  • A to G, chromosome 6 at 146,373,173 bp
  • G to A, chromosome 7 at 29,534,760 bp
  • T to C, chromosome 7 at 29,845,438 bp
  • T to A, chromosome 7 at 44,624,330 bp
  • G to A, chromosome 7 at 126,591,079 bp
  • G to A, chromosome 8 at 19,693,688 bp
  • T to C, chromosome 8 at 24,884,455 bp
  • C to T, chromosome 8 at 40,824,731 bp
  • T to C, chromosome 8 at 83,295,247 bp
  • A to G, chromosome 9 at 19,585,430 bp
  • G to A, chromosome 9 at 56,136,696 bp
  • G to C, chromosome 9 at 59,640,110 bp
  • G to T, chromosome 9 at 106,236,477 bp
  • T to C, chromosome 10 at 19,011,832 bp
  • TCACCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCACCAC, chromosome 11 at 23,364,480 bp
  • A to G, chromosome 11 at 61,213,494 bp
  • T to A, chromosome 11 at 67,188,477 bp
  • T to C, chromosome 11 at 67,246,401 bp
  • A to T, chromosome 11 at 80,060,166 bp
  • A to G, chromosome 11 at 99,915,214 bp
  • T to A, chromosome 12 at 76,405,740 bp
  • A to T, chromosome 12 at 81,421,761 bp
  • A to T, chromosome 12 at 87,162,063 bp
  • G to A, chromosome 13 at 40,015,388 bp
  • G to T, chromosome 13 at 59,796,845 bp
  • C to T, chromosome 14 at 54,282,332 bp
  • A to G, chromosome 14 at 59,630,180 bp
  • T to G, chromosome 14 at 64,031,270 bp
  • C to A, chromosome 14 at 68,577,904 bp
  • A to G, chromosome 14 at 99,133,351 bp
  • T to A, chromosome 15 at 36,099,933 bp
  • T to C, chromosome 15 at 99,470,838 bp
  • T to C, chromosome 16 at 4,991,943 bp
  • C to T, chromosome 16 at 14,269,241 bp
  • C to T, chromosome 16 at 58,925,690 bp
  • C to T, chromosome 16 at 73,904,378 bp
  • T to A, chromosome 17 at 3,197,985 bp
  • A to G, chromosome 17 at 31,557,606 bp
  • A to G, chromosome 17 at 34,672,540 bp
  • T to A, chromosome 18 at 15,063,227 bp
  • G to A, chromosome 19 at 12,935,097 bp
  • T to A, chromosome 19 at 36,978,372 bp
  • T to C, chromosome 19 at 38,749,396 bp
  • T to A, chromosome X at 15,110,847 bp
  • T to G, chromosome X at 74,338,948 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4673 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
041928-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.