Strain Name:
C57BL/6J-MtgxR4744Btlr/Mmmh
Stock Number:
042027-MU
Citation ID:
RRID:MMRRC_042027-MU
Other Names:
R4744 (G1), C57BL/6J-MtgxR4744Btlr
Major Collection:

Strain Information

Sufu
Name: SUFU negative regulator of hedgehog signaling
Synonyms: Su(Fu), 2810026F04Rik, b2b273Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24069
Homologene: 9262
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Gcg
Name: glucagon
Synonyms: GLP-1, glucagon-like peptide I, Glu, PPG
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14526
HGNC: HGNC:4191
Homologene: 1553
Septin3
Name: septin 3
Synonyms: Sep3, B530002E20Rik, 3110018K01Rik, Sept3, Gm46500
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 24050
VEGA: 15
Homologene: 99740
Rnf10
Name: ring finger protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50849
Homologene: 40990
Rbm47
Name: RNA binding motif protein 47
Synonyms: 9530077J19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 245945
Homologene: 36932
Jak2
Name: Janus kinase 2
Synonyms: C81284
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16452
VEGA: 19
HGNC: HGNC:6192
Homologene: 21033
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Sirt2
Name: sirtuin 2
Synonyms: SIR2L2, Sir2l, 5730427M03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64383
Homologene: 40823
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Alkbh8
Name: alkB homolog 8, tRNA methyltransferase
Synonyms: 8030431D03Rik, 9430088N01Rik, 4930562C03Rik, Abh8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67667
Homologene: 44488
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Brap
Name: BRCA1 associated protein
Synonyms: 3010002G07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72399
HGNC: HGNC:1099
Homologene: 4926
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Panx1
Name: pannexin 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55991
HGNC: HGNC:8599
Homologene: 49416
Fzd7
Name: frizzled class receptor 7
Synonyms: Fz7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14369
HGNC: HGNC:4045
Homologene: 20751
Usf2
Name: upstream transcription factor 2
Synonyms: Usf-2, bHLHb12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22282
Homologene: 2527
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Etnk1
Name: ethanolamine kinase 1
Synonyms: 1110061E11Rik, EKI1, 4930555L11Rik, D6Ertd3e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75320
Homologene: 10240
Galnt14
Name: polypeptide N-acetylgalactosaminyltransferase 14
Synonyms: 0610033M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71685
Homologene: 56997
Nck1
Name: non-catalytic region of tyrosine kinase adaptor protein 1
Synonyms: Nck, D230010O13Rik, 6330586M15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17973
HGNC: HGNC:7664
Homologene: 38148
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20498
Homologene: 21056
F11r
Name: F11 receptor
Synonyms: BV11 antigen, Ly106, JAM-1, ESTM33, Jcam1, JAM-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16456
Homologene: 14255
Sv2b
Name: synaptic vesicle glycoprotein 2b
Synonyms: A830038F04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64176
Homologene: 32236
Invs
Name: inversin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16348
Homologene: 7786
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Slc1a1
Name: solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
Synonyms: MEAAC1, EAAC1, EAAT3, D130048G10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20510
Homologene: 20881
Add2
Name: adducin 2
Synonyms: 2900072M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11519
HGNC: HGNC:244
Homologene: 1221
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Hsf5
Name: heat shock transcription factor family member 5
Synonyms: LOC327992
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327992
Homologene: 52701
Unc13c
Name: unc-13 homolog C
Synonyms: Munc13-3, Unc13h3, D9Ertd414e, 1500037O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208898
Homologene: 45443
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Pilra
Name: paired immunoglobin-like type 2 receptor alpha
Synonyms: FDF03
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231805
Homologene: 8387
Rhobtb2
Name: Rho-related BTB domain containing 2
Synonyms: Dbc2, E130206H14Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 246710
VEGA: 14
Homologene: 22873
Slc6a9
Name: solute carrier family 6 (neurotransmitter transporter, glycine), member 9
Synonyms: Glyt-1, Glyt1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14664
Homologene: 5050
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: NMDAR2B, NR2B, Nmdar2b, GluRepsilon2, GluN2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Slc28a2b
Name: solute carrier family 28 member 2b
Synonyms: Gm14085
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381417
Agap2
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Hhipl1
Name: hedgehog interacting protein-like 1
Synonyms: 1600002O04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 214305
VEGA: 12
Homologene: 81985
Dhh
Name: desert hedgehog
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13363
VEGA: 15
HGNC: HGNC:2865
Homologene: 22431
St6galnac6
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Synonyms: ST6GalNAcVI, Siat7f
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50935
Homologene: 8390
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Tex10
Name: testis expressed gene 10
Synonyms: clone 18330, 2810462N03Rik, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
4933427D14Rik
Name: RIKEN cDNA 4933427D14 gene
Synonyms: Gm43951
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74477
Homologene: 8874
Ugt3a2
Name: UDP glycosyltransferases 3 family, polypeptide A2
Synonyms: Ugt3a, Ugt3a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105887
Homologene: 122787
Gpr141
Name: G protein-coupled receptor 141
Synonyms: Pgr13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 353346
VEGA: 13
Homologene: 18771
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Pdhx
Name: pyruvate dehydrogenase complex, component X
Synonyms: Pdx1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27402
Homologene: 55757
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269233
Homologene: 19521
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242248
Homologene: 9926
Pabpc2
Name: poly(A) binding protein, cytoplasmic 2
Synonyms: Pabp2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18459
Homologene: 56509
Fignl1
Name: fidgetin-like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 60530
Homologene: 11063
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627479
Homologene: 129606
Nmur2
Name: neuromedin U receptor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216749
Homologene: 49618
Ggt1
Name: gamma-glutamyltransferase 1
Synonyms: GGT, CD224, Ggtp, dwg
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14598
Homologene: 68450
Dhrs7
Name: dehydrogenase/reductase 7
Synonyms: retDSR4, retSDR4, 2310016E22Rik, 5730564L20Rik, dehydrogenase/reductase (SDR family) member 7
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66375
VEGA: 12
Homologene: 9350
Acvr2b
Name: activin receptor IIB
Synonyms: ActRIIB
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11481
VEGA: 9
HGNC: HGNC:174
Homologene: 863
4930519G04Rik
Name: RIKEN cDNA 4930519G04 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67593
Homologene: 87032
Scarf2
Name: scavenger receptor class F, member 2
Synonyms: Srec2, SREC-II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224024
VEGA: 16
Homologene: 17817
Cyb5r2
Name: cytochrome b5 reductase 2
Synonyms: D630003K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320635
Homologene: 6182
Fpr-rs7
Name: formyl peptide receptor, related sequence 7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 321021
HGNC: HGNC:3827
Pigz
Name: phosphatidylinositol glycan anchor biosynthesis, class Z
Synonyms: F630022B06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239827
Homologene: 130742
Ocel1
Name: occludin/ELL domain containing 1
Synonyms: 9430098E02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77090
Homologene: 11597
Or1j16
Name: olfactory receptor family 1 subfamily J member 16
Synonyms: GA_x6K02T2NLDC-33334179-33335114, MOR136-7, Olfr345
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258947
Homologene: 45069
Tapbpl
Name: TAP binding protein-like
Synonyms: TAPBPL-R
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213233
Homologene: 9958
Ebpl
Name: emopamil binding protein-like
Synonyms: 5730442K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68177
VEGA: 14
Homologene: 12243
AU015228
Name: expressed sequence AU015228
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
NCBI: 99169
Gm16551
Name: predicted gene 16551
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 9
NCBI: 100503019
Gm9972
Name: predicted gene 9972
Type: Gene
Species: Mouse
Chromosome: 11
Gm27325
Name: predicted gene, 27325
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 59,484,436 bp
  • A to T, chromosome 1 at 135,982,458 bp
  • T to G, chromosome 1 at 150,577,612 bp
  • T to A, chromosome 1 at 171,460,598 bp
  • T to C, chromosome 2 at 3,224,909 bp
  • A to G, chromosome 2 at 32,618,543 bp
  • A to T, chromosome 2 at 36,640,979 bp
  • T to C, chromosome 2 at 52,150,577 bp
  • T to A, chromosome 2 at 62,478,631 bp
  • A to G, chromosome 2 at 102,737,869 bp
  • A to T, chromosome 2 at 103,042,296 bp
  • A to G, chromosome 2 at 120,696,123 bp
  • A to T, chromosome 2 at 121,211,313 bp
  • A to T, chromosome 2 at 122,522,805 bp
  • A to T, chromosome 2 at 130,100,629 bp
  • G to T, chromosome 3 at 136,247,689 bp
  • T to C, chromosome 4 at 48,397,609 bp
  • A to G, chromosome 4 at 48,469,990 bp
  • G to T, chromosome 4 at 55,011,598 bp
  • A to T, chromosome 4 at 117,867,895 bp
  • T to C, chromosome 5 at 8,078,699 bp
  • T to C, chromosome 5 at 63,806,967 bp
  • T to C, chromosome 5 at 66,026,693 bp
  • T to A, chromosome 5 at 108,808,581 bp
  • T to C, chromosome 5 at 114,879,556 bp
  • T to C, chromosome 5 at 115,251,414 bp
  • T to A, chromosome 5 at 121,662,130 bp
  • T to C, chromosome 5 at 137,835,507 bp
  • A to G, chromosome 6 at 86,110,888 bp
  • G to A, chromosome 6 at 125,228,285 bp
  • G to A, chromosome 6 at 135,778,699 bp
  • A to C, chromosome 6 at 143,186,593 bp
  • T to C, chromosome 7 at 28,777,013 bp
  • T to A, chromosome 7 at 28,787,780 bp
  • A to T, chromosome 7 at 30,954,772 bp
  • T to C, chromosome 7 at 75,206,518 bp
  • G to T, chromosome 7 at 107,750,277 bp
  • A to G, chromosome 8 at 71,372,753 bp
  • A to G, chromosome 8 at 105,965,989 bp
  • G to A, chromosome 9 at 3,344,604 bp
  • A to G, chromosome 9 at 15,010,298 bp
  • T to C, chromosome 9 at 59,905,996 bp
  • T to C, chromosome 9 at 73,931,844 bp
  • T to A, chromosome 9 at 74,850,871 bp
  • T to C, chromosome 9 at 100,506,744 bp
  • T to C, chromosome 9 at 119,431,262 bp
  • A to G, chromosome 10 at 75,585,899 bp
  • T to C, chromosome 10 at 127,090,203 bp
  • A to G, chromosome 11 at 11,801,585 bp
  • A to G, chromosome 11 at 43,036,690 bp
  • A to G, chromosome 11 at 56,040,835 bp
  • T to C, chromosome 11 at 72,175,539 bp
  • G to A, chromosome 11 at 84,994,393 bp
  • T to A, chromosome 11 at 87,622,791 bp
  • A to G, chromosome 11 at 120,016,122 bp
  • T to A, chromosome 12 at 66,797,727 bp
  • T to A, chromosome 12 at 72,652,251 bp
  • A to T, chromosome 12 at 108,319,979 bp
  • T to A, chromosome 13 at 19,751,714 bp
  • A to G, chromosome 14 at 61,360,233 bp
  • A to G, chromosome 14 at 69,794,002 bp
  • T to A, chromosome 15 at 9,310,553 bp
  • T to C, chromosome 15 at 82,290,457 bp
  • T to A, chromosome 15 at 91,797,474 bp
  • A to G, chromosome 15 at 98,894,258 bp
  • C to T, chromosome 16 at 11,349,909 bp
  • G to A, chromosome 16 at 17,803,516 bp
  • A to T, chromosome 16 at 31,945,333 bp
  • T to A, chromosome 16 at 77,114,989 bp
  • A to T, chromosome 17 at 20,114,003 bp
  • G to T, chromosome 17 at 73,507,833 bp
  • A to G, chromosome 18 at 39,774,828 bp
  • TGCCGCCGCCGCCGCCGCCGCCGCCGCC to TGCCGCCGCCGCCGCCGCCGCCGCC, chromosome 18 at 43,477,717 bp
  • A to T, chromosome 19 at 28,894,525 bp
  • T to A, chromosome 19 at 29,262,256 bp
  • A to G, chromosome 19 at 46,483,630 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R4744 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042027-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.