Strain Name:
C57BL/6J-MtgxR5311Btlr/Mmmh
Stock Number:
042894-MU
Citation ID:
RRID:MMRRC_042894-MU
Other Names:
R5311 (G1), C57BL/6J-MtgxR5311Btlr
Major Collection:

Strain Information

Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Fam53a
Name: family with sequence similarity 53, member A
Synonyms: 5430419M09Rik, DNTNP, 2410018C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74504
Homologene: 18660
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Nckap1
Name: NCK-associated protein 1
Synonyms: mh19, Hem-2, H19, Nap1, Hem2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50884
HGNC: HGNC:7666
Homologene: 8384
Trps1
Name: transcriptional repressor GATA binding 1
Synonyms: D15Ertd586e, trichorhinophalangeal syndrome I (human)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 83925
Homologene: 8556
Gfm2
Name: G elongation factor, mitochondrial 2
Synonyms: MST027, EFG2, A930009M04Rik, 6530419G12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320806
Homologene: 6238
Cdc45
Name: cell division cycle 45
Synonyms: Cdc45l
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12544
HGNC: HGNC:1739
Homologene: 2616
Gm14403
Name: predicted gene 14403
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433520
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Ap5z1
Name: adaptor-related protein complex 5, zeta 1 subunit
Synonyms: C330006K01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231855
Homologene: 18213
Jup
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Fchsd1
Name: FCH and double SH3 domains 1
Synonyms: A030002D08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319262
Homologene: 14127
Ext2
Name: exostosin glycosyltransferase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14043
HGNC: HGNC:3513
Homologene: 345
Zfp667
Name: zinc finger protein 667
Synonyms: A830025F02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384763
Homologene: 23343
Pde4d
Name: phosphodiesterase 4D, cAMP specific
Synonyms: dunce, Dpde3, 9630011N22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238871
HGNC: HGNC:8783
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: CD169, Siglec-1, Sn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20612
Homologene: 124458
Mybpc3
Name: myosin binding protein C, cardiac
Synonyms: cardiac C-protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17868
HGNC: HGNC:7551
Homologene: 215
Mdh1b
Name: malate dehydrogenase 1B, NAD (soluble)
Synonyms: 1700124B08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76668
Homologene: 57110
Snrk
Name: SNF related kinase
Synonyms: SNRK, 2010012F07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20623
Homologene: 9797
Zfp941
Name: zinc finger protein 941
Synonyms: BC066028
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 407812
Mtpap
Name: mitochondrial poly(A) polymerase
Synonyms: 0610027A18Rik, Papd1, Tent6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67440
VEGA: 18
Homologene: 10008
Vmn2r10
Name: vomeronasal 2, receptor 10
Synonyms: VR16, V2r16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22307
Homologene: 129606
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Fshr
Name: follicle stimulating hormone receptor
Synonyms: follicle-stimulating hormone receptor, Follitropin receptor, FSH-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14309
VEGA: 17
HGNC: HGNC:3969
Homologene: 117
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap-1, Mtap1, 6330416M19Rik, Mtap1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Edar
Name: ectodysplasin-A receptor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13608
HGNC: HGNC:2895
Homologene: 7699
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, Mlck, MLCK210, MLCK108, 9530072E15Rik, A930019C19Rik, nmMlck
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Or8j3b
Name: olfactory receptor family 8 subfamily J member 3B
Synonyms: GA_x6K02T2Q125-47844843-47843896, MOR185-11, Olfr1057
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404325
Homologene: 83135
Serpina11
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11
Synonyms: LOC380780
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380780
Homologene: 28490
Itih2
Name: inter-alpha trypsin inhibitor, heavy chain 2
Synonyms: Intin2, Itih-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16425
HGNC: HGNC:6167
Homologene: 1668
Rimbp3
Name: RIMS binding protein 3
Synonyms: LOC239731, LOC385766, RIM-BP3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239731
Homologene: 77940
Slfn8
Name: schlafen 8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276950
Homologene: 45432
Skint7
Name: selection and upkeep of intraepithelial T cells 7
Synonyms: C130057D23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 328505
Homologene: 106613
Tmem8b
Name: transmembrane protein 8B
Synonyms: 4930500O05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242409
Homologene: 72894
Ugt2b35
Name: UDP glucuronosyltransferase 2 family, polypeptide B35
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243085
Homologene: 128251
Lgi2
Name: leucine-rich repeat LGI family, member 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246316
Homologene: 10048
Gm15270
Name: predicted gene 15270
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 10
NCBI: 102638890
Mrgprb3
Name: MAS-related GPR, member B3
Synonyms: MrgB3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404238
Homologene: 138632
Gm6899
Name: predicted gene 6899
Type: Gene
Species: Mouse
Chromosome: 11
Or1af1
Name: olfactory receptor family 1 subfamily AF member 1
Synonyms: GA_x6K02T2NLDC-33902472-33903401, MOR138-5P, MOR138-6, Olfr366
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 236509
Homologene: 114744
Vmn1r219
Name: vomeronasal 1 receptor 219
Synonyms: V1rh13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171272
Homologene: 110880
Zdhhc3
Name: zinc finger, DHHC domain containing 3
Synonyms: Zfp373, 1110020O22Rik, GODZ, 1810006O10Rik, 2210017C02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69035
Homologene: 9582
Ubash3a
Name: ubiquitin associated and SH3 domain containing, A
Synonyms: 5830413C03Rik, Sts-2, TULA
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328795
Homologene: 56833
Gm5431
Name: predicted gene 5431
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432555
Gm14295
Name: predicted gene 14295
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100039123
Homologene: 133105
Or12d14-ps1
Name: olfactory receptor family 12 subfamily D member 14, pseudogene 1
Synonyms: MOR250-5, GA_x6K02T2PSCP-1823235-1824161, Olfr104-ps, Olfr104
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257948
Gm8181
Name: predicted gene 8181
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 18
NCBI: 666594
VEGA: 18
Gm15587
Name: predicted gene 15587
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 5
Gm10115
Name: predicted gene 10115
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,565,870 bp
  • T to A, chromosome 1 at 38,079,393 bp
  • A to G, chromosome 1 at 63,720,004 bp
  • T to C, chromosome 2 at 6,950,894 bp
  • T to C, chromosome 2 at 10,110,535 bp
  • T to C, chromosome 2 at 37,219,621 bp
  • T to A, chromosome 2 at 80,540,122 bp
  • T to A, chromosome 2 at 86,374,750 bp
  • T to A, chromosome 2 at 91,128,678 bp
  • T to C, chromosome 2 at 93,696,261 bp
  • C to A, chromosome 2 at 121,302,387 bp
  • T to C, chromosome 2 at 131,079,316 bp
  • A to T, chromosome 2 at 176,810,672 bp
  • AAACCCTA to AA, chromosome 2 at 177,509,655 bp
  • G to A, chromosome 4 at 43,673,992 bp
  • T to C, chromosome 4 at 45,917,556 bp
  • G to A, chromosome 4 at 111,980,304 bp
  • A to T, chromosome 5 at 24,377,345 bp
  • A to G, chromosome 5 at 33,607,736 bp
  • A to T, chromosome 5 at 52,554,485 bp
  • G to A, chromosome 5 at 87,011,280 bp
  • T to C, chromosome 5 at 109,006,255 bp
  • A to G, chromosome 5 at 110,289,278 bp
  • A to G, chromosome 5 at 142,467,687 bp
  • A to G, chromosome 7 at 6,305,716 bp
  • C to T, chromosome 7 at 48,643,311 bp
  • C to A, chromosome 7 at 140,811,959 bp
  • A to C, chromosome 9 at 53,518,623 bp
  • G to C, chromosome 9 at 122,166,320 bp
  • A to G, chromosome 9 at 123,084,166 bp
  • A to G, chromosome 10 at 24,595,801 bp
  • G to A, chromosome 10 at 58,607,435 bp
  • A to G, chromosome 10 at 103,214,587 bp
  • GGAGGCCGCCCAGTGGCAGAGGCCGCCCAGTGGCAGAGGC to GGAGGCCGCCCAGTGGCAGAGGC, chromosome 11 at 26,593,725 bp
  • T to A, chromosome 11 at 48,888,889 bp
  • T to C, chromosome 11 at 83,004,084 bp
  • T to C, chromosome 11 at 100,372,494 bp
  • A to T, chromosome 12 at 103,985,962 bp
  • T to A, chromosome 13 at 23,162,893 bp
  • G to A, chromosome 13 at 97,163,151 bp
  • C to A, chromosome 13 at 109,632,864 bp
  • C to T, chromosome 13 at 109,632,865 bp
  • G to A, chromosome 15 at 50,664,760 bp
  • A to G, chromosome 16 at 17,210,844 bp
  • C to T, chromosome 16 at 18,795,897 bp
  • A to G, chromosome 16 at 34,921,757 bp
  • A to G, chromosome 16 at 49,165,841 bp
  • G to A, chromosome 17 at 20,029,901 bp
  • A to G, chromosome 17 at 31,219,717 bp
  • G to A, chromosome 17 at 37,362,881 bp
  • A to T, chromosome 17 at 89,011,013 bp
  • T to A, chromosome 18 at 4,386,328 bp
  • C to T, chromosome 18 at 37,959,873 bp
  • A to T, chromosome 18 at 43,171,505 bp
  • C to A, chromosome 19 at 6,531,398 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5311 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
042894-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.